ORFeome > nkap ORF1 – XORFeome v1.0

nkap ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nkap
Gene ID: 6252186
Gene Page ID: 6459442
ORF Xenbase ID: 17286417

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125989
Original XGC clone length: 981

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ838791
dbEST ID: 79656493
Trimmed Sequence: ATGGGACCTATTAGCCGTTCCAGGAGCAGAAGTTCTGATTATTCACCGCGGAAAAGGCGGCACGGAAGCGACGAGCGATCTCCAGACAGGAGAGTAAGAAGATCTAGATCCAGGGAACGAGTGGCTGTCAATGATCACCGCCGAAGCCGGTCCGGAGAGCAAGCTTTCTCAGGCCGACCCCACCACGGGAAACAATGGGGAGACTACACTGAGAAGGGGAAGGAGGAGCTTTTGAGGCAAAGGCAGGACGCTTTCATTGCAAGGCGTTTAAAAGAAAGAGAGAGAATTGGTGAGCTTGGAGCTCCAGAAGTTTGGGGTCTTTCACCTAAAGTTCTTGAACCTGATTCTGATGAGCACACACCCGTAGAAGAGGACGAAAAGTCAAACAAATCAAGCAGTTCTGAATCTTCAGAAGATGAAGATAAGAAAAAGAAGTCTAAGAAAAGGAAGAAAAAACACATGAAAAAGAAGTCAAAGAAAAAAAGAAGCAAGAAAGTAAAGGAAGAAAGCAGTGATTCAAGCAGTGAATATTCATATGATGAAAAAGAGGAAGAAGATCAATGGGTTGAGAAAACAAAAAATAATTTAGATGAGTTTGAATTTGTGGGGACCAGAAGCACCAATTACCACATCGGTCGCAAGGAAGAAAAAACCATTAAATTTTGGTCCTTGCTTTGCTGCCTGGGGGAAGGGGGCAGCCAGGGGCAAAATATGGTGAAAGCCGGGAAAAGCGGTAATTCAAAGAAAAAAGGGGGAAATTTGGGCTCCAACGAAGTGGGGATGAAAAATTTGTCTTTCATTCTCCAAAAAAGGTCTGGG
Full Trace Sequence: CGGGGTTCTAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGACCTATTAGCCGTTCCAGGAGCAGAAGTTCTGATTATTCACCGCGGAAAAGGCGGCACGGAAGCGACGAGCGATCTCCAGACAGGAGAGTAAGAAGATCTAGATCCAGGGAACGAGTGGCTGTCAATGATCACCGCCGAAGCCGGTCCGGAGAGCAAGCTTTCTCAGGCCGACCCCACCACGGGAAACAATGGGGAGACTACACTGAGAAGGGGAAGGAGGAGCTTTTGAGGCAAAGGCAGGACGCTTTCATTGCAAGGCGTTTAAAAGAAAGAGAGAGAATTGGTGAGCTTGGAGCTCCAGAAGTTTGGGGTCTTTCACCTAAAGTTCTTGAACCTGATTCTGATGAGCACACACCCGTAGAAGAGGACGAAAAGTCAAACAAATCAAGCAGTTCTGAATCTTCAGAAGATGAAGATAAGAAAAAGAAGTCTAAGAAAAGGAAGAAAAAACACATGAAAAAGAAGTCAAAGAAAAAAAGAAGCAAGAAAGTAAAGGAAGAAAGCAGTGATTCAAGCAGTGAATATTCATATGATGAAAAAGAGGAAGAAGATCAATGGGTTGAGAAAACAAAAAATAATTTAGATGAGTTTGAATTTGTGGGGACCAGAAGCACCAATTACCACATCGGTCGCAAGGAAGAAAAAACCATTAAATTTTGGTCCTTGCTTTGCTGCCTGGGGGAAGGGGGCAGCCAGGGGCAAAATATGGTGAAAGCCGGGAAAAGCGGTAATTCAAAGAAAAAAGGGGGAAATTTGGGCTCCAACGAAGTGGGGATGAAAAATTTGTCTTTCATTCTCCAAAAAAGGTCTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGACCTATTAGCCGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838790
dbEST ID: 79656492
Trimmed Sequence: TTTGTCCTCCTTTCCTTTTGTCTTTCTATAAACCATCTCTCTGAAGCTGGACAAGATCTTGTTTTCACGTTTACTCCTTTCCTCTTGATTGAATGACGCCAGGGCCCTCTTTTCATCTGCACTGTAAATCTGGTTTTCCTTACGCAGACGCACAGCCTCCATACGGCGATGTCTGCTACCGCTCATCACATAGCCAGACTTTTCGAATGAAGCAATTTCATCACTCGTTAGACCAATTTCACCTCTTCTTGGAATACGCTTTCCAGCTTTCACATACTCTGCCATGGCTGCACCTTCACCAGGCAGCAAAGCATGACCAAAATTTAATGGTTTATCATCTTGCGACAGATGTGTAATTGGTGCTTCTGGTCCCACAAATTCAAACTCATCTAAATTATTTTTTGTTTTCTCAACCCATTGATCTTCTTCCTCTTTTTCATCATCTGAATCTTCACTGCTTGAATCACTGCTTTCTTCCTTTACTTTCTTGCTTCTTTTTTTCTTTGACTTCTTTTTCATGTGTTTTTTCTTCCTTTTCTTAGACTTCTTTTTCTTATCTTCATCTTCTGAAGATTCAGAACTGCTTGATTTGTTTGACTTTTCGTCCTCTTCTACAGGTGTGTGCTCATCAAAATCAGGTTCAAGAACTTTTAGGTGAAAGAACCCCAACTTCCGGGACCTCCCAGCTCACCAAATTCTCTCTCTTTCTTTTTAAAGCCCTTTGGCATGGAAACGGTCCCTGGCCTTTTCCCCTCAAAAGC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGTCCTCCTTTCCTTTTGTCTTTCTATAAACCATCTCTCTGAAGCTGGACAAGATCTTGTTTTCACGTTTACTCCTTTCCTCTTGATTGAATGACGCCAGGGCCCTCTTTTCATCTGCACTGTAAATCTGGTTTTCCTTACGCAGACGCACAGCCTCCATACGGCGATGTCTGCTACCGCTCATCACATAGCCAGACTTTTCGAATGAAGCAATTTCATCACTCGTTAGACCAATTTCACCTCTTCTTGGAATACGCTTTCCAGCTTTCACATACTCTGCCATGGCTGCACCTTCACCAGGCAGCAAAGCATGACCAAAATTTAATGGTTTATCATCTTGCGACAGATGTGTAATTGGTGCTTCTGGTCCCACAAATTCAAACTCATCTAAATTATTTTTTGTTTTCTCAACCCATTGATCTTCTTCCTCTTTTTCATCATCTGAATCTTCACTGCTTGAATCACTGCTTTCTTCCTTTACTTTCTTGCTTCTTTTTTTCTTTGACTTCTTTTTCATGTGTTTTTTCTTCCTTTTCTTAGACTTCTTTTTCTTATCTTCATCTTCTGAAGATTCAGAACTGCTTGATTTGTTTGACTTTTCGTCCTCTTCTACAGGTGTGTGCTCATCAAAATCAGGTTCAAGAACTTTTAGGTGAAAGAACCCCAACTTCCGGGACCTCCCAGCTCACCAAATTCTCTCTCTTTCTTTTTAAAGCCCTTTGGCATGGAAACGGTCCCTGGCCTTTTCCCCTCAAAAGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGTCCTCCTTTCCTTTTGTCT