ORFeome > nkiras1 ORF1 – XORFeome v1.0

nkiras1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nkiras1
Gene ID: 865064
Gene Page ID: 484257
ORF Xenbase ID: 17286423

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126034
Original XGC clone length: 579

Human orthology & disease relationships

NCBI Entrez ID: 28512
Ensembl gene IDs: ENSG00000197885
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 300291,300301,300584,308300,609283

Library Location

Plate ID: GDExl11084
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ837558
dbEST ID: 79655260
Trimmed Sequence: ATGGGGAAAGGCAGCAAAGTGGTTGTTTGTGGTTTTGCAGCAGTTGGTAAAACTGCAATCCTAGAGCAGCTACTATATGGAAACTACAGATTAGATCTGGAACCTATTAAAACCCTGGAAGATGTATATATTGCTACAGTGGAAACAGACCGTGGCGTAAAAGAGCAGTTGCGCCTTTATGATACCCAGGGAGTGCGAGAAGACACTGAATTGCCCAAACACTACTTTTCATTTGCTGATGGCTTTATTCTTGTCTACAGTATCAATTGTTTAGAATCATTCAAGAGAGTTAAACTGTTAAAGAAAGAAGTAGACAAATTCAGCGACAAGAAAGAGGTTGTAATTATTGTTTTGGGGAACAAAATGGATCTTGCAGGACAGAGGCAAGTGGACACTGACATGGCACAGCAATGGGCAAAGAGTGAAAGAATGAAGCTATGGGAGGTGTCTGTAACAGACAGGAAGACATTGACAGAACCATTCACATTGCTGGCTAGCAAGCTAAATCAGCTGCAATCCAAATCCACTTTTCCTTTGCCGGGAAGAAAAAACAAAGGCACACCATCTTCTGATAACTT
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAAAGGCAGCAAAGTGGTTGTTTGTGGTTTTGCAGCAGTTGGTAAAACTGCAATCCTAGAGCAGCTACTATATGGAAACTACAGATTAGATCTGGAACCTATTAAAACCCTGGAAGATGTATATATTGCTACAGTGGAAACAGACCGTGGCGTAAAAGAGCAGTTGCGCCTTTATGATACCCAGGGAGTGCGAGAAGACACTGAATTGCCCAAACACTACTTTTCATTTGCTGATGGCTTTATTCTTGTCTACAGTATCAATTGTTTAGAATCATTCAAGAGAGTTAAACTGTTAAAGAAAGAAGTAGACAAATTCAGCGACAAGAAAGAGGTTGTAATTATTGTTTTGGGGAACAAAATGGATCTTGCAGGACAGAGGCAAGTGGACACTGACATGGCACAGCAATGGGCAAAGAGTGAAAGAATGAAGCTATGGGAGGTGTCTGTAACAGACAGGAAGACATTGACAGAACCATTCACATTGCTGGCTAGCAAGCTAAATCAGCTGCAATCCAAATCCACTTTTCCTTTGCCGGGAAGAAAAAACAAAGGCACACCATCTTCTGATAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAACAATGCTTATCAATTTGTTTGCACGAAACGGGTCACTAACAATTCAAAATAAAAACAATAATTGCCATCCAACCTAATAACCCCCAAAAACAAGTCGGTATTACCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGACCAGGGGCAAAAAACCCCCTCCAAAATTCAAAAAACCCGGACAAAAAAAAAANCACAAGGCGGGCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAAAGGCAGCAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837557
dbEST ID: 79655259
Trimmed Sequence: GTTATCAGAAGATGGTGTGCCTTTGCTTTTTCTTCCCGGCAAAGGAAAAGTGGATTTGGATTGCAGCTGATTTAGCTTGCTAGCCAGCAATGTGAATGGTTCTGTCAATGTCTTCCTGTCTGTTACAGACACCTCCCATAGCTTCATTCTTTCACTCTTTGCCCATTGCTGTGCCATGTCAGTGTCCACTTGCCTCTGTCCTGCAAGATCCATTTTGTTCCCCAAAACAATAATTACAACCTCTTTCTTGTCGCTGAATTTGTCTACTTCTTTCTTTAACAGTTTAACTCTCTTGAATGATTCTGAACAATTGATACTGTAGACAAGAATAAAGCCATCACCAAATGAAAAGTAGTGTTTGGGCGGGTCAGTGTCTTCTCTCACTCCCGGGGTATCGTAAAGGCGCAGCTGCTCTTTTACTCCACGGTCGGTTTCCACTGTAGCAGTATATACATCTTCCAGGGTTGTGGTAGGTTCGGGATCCTATCTGTAGTTTCGGGATATAGCTGGCTCGCGGATGGGGGTTGACAACTGCTACGAGGGCAGAACAAGCCAATTACCGGCTTGTCGCGTGTTGCCGAGGTTGGTGGTACTGGTGGGCGTTGGTAAAGAACAAAGGACATGATTTTTTTTCCATCGGAGGGGCCACTGTGGGGCGAGTTTAGAAAAAAAAAAAAAAAAAGAAAGAAAGAGAAGGGACCGTAGAGCGGACGCGGCCGCCCACAATGAAAAAAAGAGGGGGGGGGGGTNAANAGAGGANNGGGGG
Full Trace Sequence: GAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTATCAGAAGATGGTGTGCCTTTGCTTTTTCTTCCCGGCAAAGGAAAAGTGGATTTGGATTGCAGCTGATTTAGCTTGCTAGCCAGCAATGTGAATGGTTCTGTCAATGTCTTCCTGTCTGTTACAGACACCTCCCATAGCTTCATTCTTTCACTCTTTGCCCATTGCTGTGCCATGTCAGTGTCCACTTGCCTCTGTCCTGCAAGATCCATTTTGTTCCCCAAAACAATAATTACAACCTCTTTCTTGTCGCTGAATTTGTCTACTTCTTTCTTTAACAGTTTAACTCTCTTGAATGATTCTGAACAATTGATACTGTAGACAAGAATAAAGCCATCACCAAATGAAAAGTAGTGTTTGGGCGGGTCAGTGTCTTCTCTCACTCCCGGGGTATCGTAAAGGCGCAGCTGCTCTTTTACTCCACGGTCGGTTTCCACTGTAGCAGTATATACATCTTCCAGGGTTGTGGTAGGTTCGGGATCCTATCTGTAGTTTCGGGATATAGCTGGCTCGCGGATGGGGGTTGACAACTGCTACGAGGGCAGAACAAGCCAATTACCGGCTTGTCGCGTGTTGCCGAGGTTGGTGGTACTGGTGGGCGTTGGTAAAGAACAAAGGACATGATTTTTTTTCCATCGGAGGGGCCACTGTGGGGCGAGTTTAGAAAAAAAAAAAAAAAAAGAAAGAAAGAGAAGGGACCGTAGAGCGGACGCGGCCGCCCACAATGAAAAAAAGAGGGGGGGGGGGTNAANAGAGGANNGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTATCAGAAGATGGTGTGCCTTT