ORFeome > nkx6-2 ORF1 – XORFeome v1.0

nkx6-2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nkx6-2
Gene ID: 865095
Gene Page ID: 484526
ORF Xenbase ID: 17286441

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123229
Original XGC clone length: 846

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ838224
dbEST ID: 79655926
Trimmed Sequence: ATGTTATCCGTGGGACAGATGGAGAGTAACAGACAGAGCGCGTTTGTACTGAGCTCCGCTCCCCTGGCTGCGCTGCACAATATGGCCGAGATGAAGACCACTCTGTTCCCCTATACCCTGCACAACCCCAACACCTTCAAAGCCCCAGCTCTGTCCTCTCTCAACTCACAGATCCCCCTGGGGACCCCTCATGGGATTAGTGACATTCTCGGCCGACCCCTAGGGGCCTCACTGGGGTCGTGCAGTAACTTGCTCACCAGCCTGCCTCGTATTAATGGACTTGCCACTTCCACTGGGATGTACTTTAACCCTGCTGTGTCCAGGTACCCCAAACCCCTGACTGAGTTACCCGGCAGGGCCCCCATCTTCTGGCCTGGGGTTATGCAAAGCTCTCCATGGAGGGATCCCAGACTGGCCTGTCCAACCCAGGCAGGGTTAATGCTGGATAAGGACGGAAAGAAGAAACACTCCCGGCCAACCTTCTCGGGGCAGCAGATATTTGCCCTGGAGAAAACCTTCGAGCAGACCAAGTACCTGGCAGGGCCTGAGAGGGCACGACTCGCCTATTCCCTGGGCATGACTGAGAGCCAAGTCAAGGTCTGGTTCCCGAACAGAAGGACCAAGTGGAGGAAGAAACACGCAGCAGAGATGGCCACAGCCCAAAAGAAACACAACTCACAAACAAAAAAGATGAAGGAAAATTCAGAACACCGAGGAGGACGATGAAAATTACAAACCCTTGGGACCCCACCCCGAACAAAGAAAAAATTCCCGGGGTTATAAAAAAAAGCAAAAATCCCCAAAACCTTTGAAACTTTTCTTCA
Full Trace Sequence: GCGGGGGCCCAAATAANTGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTATCCGTGGGACAGATGGAGAGTAACAGACAGAGCGCGTTTGTACTGAGCTCCGCTCCCCTGGCTGCGCTGCACAATATGGCCGAGATGAAGACCACTCTGTTCCCCTATACCCTGCACAACCCCAACACCTTCAAAGCCCCAGCTCTGTCCTCTCTCAACTCACAGATCCCCCTGGGGACCCCTCATGGGATTAGTGACATTCTCGGCCGACCCCTAGGGGCCTCACTGGGGTCGTGCAGTAACTTGCTCACCAGCCTGCCTCGTATTAATGGACTTGCCACTTCCACTGGGATGTACTTTAACCCTGCTGTGTCCAGGTACCCCAAACCCCTGACTGAGTTACCCGGCAGGGCCCCCATCTTCTGGCCTGGGGTTATGCAAAGCTCTCCATGGAGGGATCCCAGACTGGCCTGTCCAACCCAGGCAGGGTTAATGCTGGATAAGGACGGAAAGAAGAAACACTCCCGGCCAACCTTCTCGGGGCAGCAGATATTTGCCCTGGAGAAAACCTTCGAGCAGACCAAGTACCTGGCAGGGCCTGAGAGGGCACGACTCGCCTATTCCCTGGGCATGACTGAGAGCCAAGTCAAGGTCTGGTTCCCGAACAGAAGGACCAAGTGGAGGAAGAAACACGCAGCAGAGATGGCCACAGCCCAAAAGAAACACAACTCACAAACAAAAAAGATGAAGGAAAATTCAGAACACCGAGGAGGACGATGAAAATTACAAACCCTTGGGACCCCACCCCGAACAAAGAAAAAATTCCCGGGGTTATAAAAAAAAGCAAAAATCCCCAAAACCTTTGAAACTTTTCTTCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTATCCGTGGGACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838223
dbEST ID: 79655925
Trimmed Sequence: CAAAGTGTCCGAATTGTTGCTGCAAGGGCTGAGAAGGTTCAAGTTTGTGGACTTGTGCTTTTTTAATAACCTGGAGATTTTTTCATCGTCCGAGTTGGGGTCCAAGGGTTTGTTATATTCATCGTCCTCCTCGTTGTCTGAACTCTCCTTCATCTTCTCTGTCTCTGAGTCGTGTTTCTTCTTGGCTGTGGCCATCTCTGCTGCGTGTCTCTTCCTCCACTTGGTCCTTCTGTTCTGGAACCAGACCTTGACTTGGCTCTCAGTCATGCCCAGGGAATAGGCGAGTCGTGCCCTCTCAGGCCCTGCCAGGTACTTGGTCTGCTCGAAGGTTTTCTCCAGGGCAAATATCTGCTGCCCCGAGAAGGTTGGCCGGGAGTGTTTCTTCTTTCCGTCCTTATCCAGCATTAACCCTGCCTGGGTTGGACAGGCCAGTCTGGGATCCCTCCATGGAGAGCTTTGCATAACCCCAGGCCAGAAGATGGGGGCCCTGCCGGGTAACTCAGTCAGGGGTTTGGGGTACCTGGACACAGCAGGGTTAAAGTACATCCCAGTGGAAGTGGCAAGTCCATTAATACAAAGCAAGCTGGTGAGCAAGTTACTGCACCAACCCCGTGAGGCCCCCAAGGGGTCGGCGGAGAATGGTCATTATCCCATGAAGGGGTCCCCAGGGGGATCTGTGAATTTAAAAAAGAACAAAACTGGGGCTTTTTAAAGGTGTTGGGGGTTGTGGCGGGGTATGGGGGGGAACGGAAAAGGGGTCTTCCTTCTCAGGGCCCGTTC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAGTGTCCGAATTGTTGCTGCAAGGGCTGAGAAGGTTCAAGTTTGTGGACTTGTGCTTTTTTAATAACCTGGAGATTTTTTCATCGTCCGAGTTGGGGTCCAAGGGTTTGTTATATTCATCGTCCTCCTCGTTGTCTGAACTCTCCTTCATCTTCTCTGTCTCTGAGTCGTGTTTCTTCTTGGCTGTGGCCATCTCTGCTGCGTGTCTCTTCCTCCACTTGGTCCTTCTGTTCTGGAACCAGACCTTGACTTGGCTCTCAGTCATGCCCAGGGAATAGGCGAGTCGTGCCCTCTCAGGCCCTGCCAGGTACTTGGTCTGCTCGAAGGTTTTCTCCAGGGCAAATATCTGCTGCCCCGAGAAGGTTGGCCGGGAGTGTTTCTTCTTTCCGTCCTTATCCAGCATTAACCCTGCCTGGGTTGGACAGGCCAGTCTGGGATCCCTCCATGGAGAGCTTTGCATAACCCCAGGCCAGAAGATGGGGGCCCTGCCGGGTAACTCAGTCAGGGGTTTGGGGTACCTGGACACAGCAGGGTTAAAGTACATCCCAGTGGAAGTGGCAAGTCCATTAATACAAAGCAAGCTGGTGAGCAAGTTACTGCACCAACCCCGTGAGGCCCCCAAGGGGTCGGCGGAGAATGGTCATTATCCCATGAAGGGGTCCCCAGGGGGATCTGTGAATTTAAAAAAGAACAAAACTGGGGCTTTTTAAAGGTGTTGGGGGTTGTGGCGGGGTATGGGGGGGAACGGAAAAGGGGTCTTCCTTCTCAGGGCCCGTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAGTGTCCGAATTGTTGCT