ORFeome > nme3 ORF1 – XORFeome v1.0

nme3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nme3
Gene ID: 6254326
Gene Page ID: 999214
ORF Xenbase ID: 17286489

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078612
Original XGC clone length: 510

Human orthology & disease relationships

NCBI Entrez ID: 4832
Ensembl gene IDs: ENSG00000103024
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 216400,223100,236250,259500,266120,277700,307030,603903,605899,609560

Library Location

Plate ID: GDExl11004
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ839659
dbEST ID: 79657361
Trimmed Sequence: ATGATCTGCCTGGTGCTCACCATCTTCGCGCACATCTTCCCTTCAGCCTGGACGGGAATCAATGAGCGCACTTTCCTGGCCATCAAGCCTGATGGTTACCAACGGCGACTGCTTGGCGAGATCATTCGCCGCTTTGAGAAAAAGGGATTCCGTCTCGTGGCCATGAAGATAGTGCAGGCCTCGGAGAAACTGCTCAAGCAGCATTACATTGCCCTGCAGGACAAGCCCTTCTATGACCGGCTGGTAAAGTACATGGGTTCTGGACCAGTGGTTGCCATGGTGTGGCAGGGCTTGGATGTGGTGAAGACTGCACGTCTAATGATCGGGGAGACAAACCCAGCTCACTCTTTGCCGGGCACAATCCGAGGAGATTTCTGCATTGATGTCGGCAGGAATGTTATACATGGCAGTGACTCCAGGGAGAGTGCCGAGCGGGAGATCGCTCTTTGGTTCCAGCCTGATGAACTTGTTTATTGGCAAGACAGTGCTGAGAGCTGGATATATGAATT
Full Trace Sequence: TCGAGGGCCCAATAAAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATCTGCCTGGTGCTCACCATCTTCGCGCACATCTTCCCTTCAGCCTGGACGGGAATCAATGAGCGCACTTTCCTGGCCATCAAGCCTGATGGTTACCAACGGCGACTGCTTGGCGAGATCATTCGCCGCTTTGAGAAAAAGGGATTCCGTCTCGTGGCCATGAAGATAGTGCAGGCCTCGGAGAAACTGCTCAAGCAGCATTACATTGCCCTGCAGGACAAGCCCTTCTATGACCGGCTGGTAAAGTACATGGGTTCTGGACCAGTGGTTGCCATGGTGTGGCAGGGCTTGGATGTGGTGAAGACTGCACGTCTAATGATCGGGGAGACAAACCCAGCTCACTCTTTGCCGGGCACAATCCGAGGAGATTTCTGCATTGATGTCGGCAGGAATGTTATACATGGCAGTGACTCCAGGGAGAGTGCCGAGCGGGAGATCGCTCTTTGGTTCCAGCCTGATGAACTTGTTTATTGGCAAGACAGTGCTGAGAGCTGGATATATGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTAAATTGGTCAAAAAAAAAAAAATAAAAAATAAAGTCCATTCTCAAAGCCTCCTTCAACTAAAAAAAAAAAAAAAGGCCCCCCTCTCTCGGCTGGCTTGGTGTGTTTTGTGGTCTCTGTGGTGGAAAGAGAAAGGGAGGGAAACACATAGGAAAAGGCGTGGTGTTTGGTTGAGTATATAAGAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCTGCCTGGTGCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ839658
dbEST ID: 79657360
Trimmed Sequence: TTCATATATCCAGCTCTCAGCACTGTCTTGCCAATAAACAAGTTCATCAGGCTGGAACCAAAGAGCGATCTCCCGCTCGGCACTCTCCCTGGAGTCACTGCCATGTATAACATTCCTGCCGACATCAATGCAGAAATCTCCTCGGATTGTGCCCGGCAAAGAGTGAGCTGGGTTTGTCTCCCCGATCATTAGACGTGCAGTCTTCACCACATCCNAGCCCTGCCACACCATGGCAACCACTGGTCCAGAACCCATGTACTTTACCAGCCGGTCATAGAAGGGCTTGTCCTGCAGGGCAATGTAATGCTGCTTGAGCAGTTTCTCCGAGGCCTGCACTATCTTCATGGCCACGAGACGGAATCCCTTTTTCTCAAAGCGGCGAATGATCTCGCCAAGCAGTCGCCGTTGGTAACCATCAGGCTTGATGGCCAGGAAAGTGCGCTCATTGATTCCCGTCCAGGCTGAAGGGAAGATGTGCGCGAAGATGGTGAGCACCAGGCAGATCATGG
Full Trace Sequence: GAAGAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCATATATCCAGCTCTCAGCACTGTCTTGCCAATAAACAAGTTCATCAGGCTGGAACCAAAGAGCGATCTCCCGCTCGGCACTCTCCCTGGAGTCACTGCCATGTATAACATTCCTGCCGACATCAATGCAGAAATCTCCTCGGATTGTGCCCGGCAAAGAGTGAGCTGGGTTTGTCTCCCCGATCATTAGACGTGCAGTCTTCACCACATCCNAGCCCTGCCACACCATGGCAACCACTGGTCCAGAACCCATGTACTTTACCAGCCGGTCATAGAAGGGCTTGTCCTGCAGGGCAATGTAATGCTGCTTGAGCAGTTTCTCCGAGGCCTGCACTATCTTCATGGCCACGAGACGGAATCCCTTTTTCTCAAAGCGGCGAATGATCTCGCCAAGCAGTCGCCGTTGGTAACCATCAGGCTTGATGGCCAGGAAAGTGCGCTCATTGATTCCCGTCCAGGCTGAAGGGAAGATGTGCGCGAAGATGGTGAGCACCAGGCAGATCATGGTGCCAACTTTTTTGTACAAAGTTGGGATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAAAAGGTCACTATCAGTCAAAATAAAACAATTATTTTGGGGCCAAAAAAAAAAATAAAAAACAATTTAACCTTCTAGTAGCTGCGCGAGCCAAACAAAAAAAAAAAGGTCTCTTTCGTCGTCCCCCGTTGTTTCTTGGTGGGTGGCGCGCGGGGGGGGGGCGCTGGGGGGAGGGAAACACAACCAGAAGCAAAAAAAAGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCATATATCCAGCTCTCAGCA