ORFeome > nme5 ORF1 – XORFeome v1.0

nme5 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nme5
Gene ID: 951093
Gene Page ID: 951086
ORF Xenbase ID: 17286513

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081235
Original XGC clone length: 660

Human orthology & disease relationships

NCBI Entrez ID: 8382
Ensembl gene IDs: ENSG00000112981
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 216400,223100,236250,259500,266120,277700,603903,605899,609560

Library Location

Plate ID: GDExl11003
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ839590
dbEST ID: 79657292
Trimmed Sequence: ATGGAACAAACTCAGACACCGGGGCTGTCTATGAAAGCTCCCAAGATTTATGTGGAAAGAAATCCTGCGAATAATAAAACCAGATGTCCTTCACAAAGCAGAAGAAATTGAGGATATCATTCTCCGGAGTGGGTTCCACATTGTTCAGAAGAGAAAAGTGCATCTCAGTCCAGAGCAATGCAGTGACTTCTACTCAGATCAGTATGGAAAGATGTTTTTTCCTAGTCTGACGGCCTATATGAGCTCAGGCCCAATAATTGCAATGACATTGGCAAGACATAATGCCATCTCACACTGGAAAGAATTAATAGGACCAGCAAACAGCTTGAAAGCAAAAGAGACACAGCCTGATAGTTTAAGGGCAATATATGGGACTGACGACCTCCGCAATGCTCGTCATGGAAGTTATTGCTTTACATCTGCTGAGAGAGAAATTCGATTTATGTTTCCTGAAGCTCTCATTGAACCTGTGCCTATCGGCCAAGCCGCTACCACTTACTTGAACTTGTTTGTCAATTCAACATTGATTGTCGGCCTCACAGAACTTTGCAAACAAAAACCAGCTGATCCATATACCTGGCTCGCTGATTGGCTTCTCAAGCATAACCCAAACAAACCAAATGTGGAACACTGTGGTAATATTCAGAACCTAACAAAATG
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACAAACTCAGACACCGGGGCTGTCTATGAAAGCTCCCAAGATTTATGTGGAAAGAAATCCTGCGAATAATAAAACCAGATGTCCTTCACAAAGCAGAAGAAATTGAGGATATCATTCTCCGGAGTGGGTTCCACATTGTTCAGAAGAGAAAAGTGCATCTCAGTCCAGAGCAATGCAGTGACTTCTACTCAGATCAGTATGGAAAGATGTTTTTTCCTAGTCTGACGGCCTATATGAGCTCAGGCCCAATAATTGCAATGACATTGGCAAGACATAATGCCATCTCACACTGGAAAGAATTAATAGGACCAGCAAACAGCTTGAAAGCAAAAGAGACACAGCCTGATAGTTTAAGGGCAATATATGGGACTGACGACCTCCGCAATGCTCGTCATGGAAGTTATTGCTTTACATCTGCTGAGAGAGAAATTCGATTTATGTTTCCTGAAGCTCTCATTGAACCTGTGCCTATCGGCCAAGCCGCTACCACTTACTTGAACTTGTTTGTCAATTCAACATTGATTGTCGGCCTCACAGAACTTTGCAAACAAAAACCAGCTGATCCATATACCTGGCTCGCTGATTGGCTTCTCAAGCATAACCCAAACAAACCAAATGTGGAACACTGTGGTAATATTCAGAACCTAACAAAATGCCAACTTTCTTGTACAAAGTTGGATTTATAAAAACCATTGGTTAACAATTTTTTGCCCCGAACGTGGCCCTTTCGGGTCCAAAAAAAAAAACAAAAATATAAAAAAAAAAAAAAAAAAAAACCAAAAAAAAAAAACATTAAAAAAGAGGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACAAACTCAGACACC

Sequences - 3ʹ (reverse) EST

Accession: JZ839589
dbEST ID: 79657291
Trimmed Sequence: TTTAGTAGGTTCTTGAATAATAACACAGTGTTCCACATCTGGTTTGTTTGGGTTATGCTTGAGAAGCCAATCAGCGAGCCATGTATATGGATCAGCTGGTTTTTGTTTGCAAAGTTCTGTGAGGCCGGCAATCAATGTTGAATTGACAAACAAGTTCAAGTAAGTGGTAGCGGCTTGGCCGATAGGCACAGGTTCAATGAGAGCTTCAGGAAACATAAATCGAATTTCTCTCTCAGCAGATGTAAAGCAATAACTTCCATGAAGAGCATTGCGGAGGTCGTCAGTCCCATATATTGCCCTTAAACTATCAGGCTGTGTCTCTTTTGCTTTCAAGCTGTTTGCTGGTCCTATTAATTCTTTCCAGTGTGAGATGGCATTATGTCTTGCCAATGTCATTGCAATTATTGGGCCTGAGCTCATATAGGCCGTCAGACTAGGAAAAAACATCTTTCCATACTGATCTGAGTAGAAGTCACTGCATTGCTCTGGACTGAGATGCACTTTTCTCTTCTGAACAATGTGGAACCCACTCCGGAGAATGATATCCTCCATTTCTTCTGCTTTGTGAAGGACATCTGGTTTTATAATAGCAAGAATTCCTACCACATAAATTTTGGGAGGTTTCCAAGACAGGCCCTGTGTCTGAATTTGGTTCATGGTGGCAAACTTTTTCGTACAATGTTGGCAAATATAAAAAAGATTTGCAAAACAAATTGTTGGAAACAAAAAAAAAAAACAAAAAGAAAAAAA
Full Trace Sequence: GGGAGAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTAGTAGGTTCTTGAATAATAACACAGTGTTCCACATCTGGTTTGTTTGGGTTATGCTTGAGAAGCCAATCAGCGAGCCATGTATATGGATCAGCTGGTTTTTGTTTGCAAAGTTCTGTGAGGCCGGCAATCAATGTTGAATTGACAAACAAGTTCAAGTAAGTGGTAGCGGCTTGGCCGATAGGCACAGGTTCAATGAGAGCTTCAGGAAACATAAATCGAATTTCTCTCTCAGCAGATGTAAAGCAATAACTTCCATGAAGAGCATTGCGGAGGTCGTCAGTCCCATATATTGCCCTTAAACTATCAGGCTGTGTCTCTTTTGCTTTCAAGCTGTTTGCTGGTCCTATTAATTCTTTCCAGTGTGAGATGGCATTATGTCTTGCCAATGTCATTGCAATTATTGGGCCTGAGCTCATATAGGCCGTCAGACTAGGAAAAAACATCTTTCCATACTGATCTGAGTAGAAGTCACTGCATTGCTCTGGACTGAGATGCACTTTTCTCTTCTGAACAATGTGGAACCCACTCCGGAGAATGATATCCTCCATTTCTTCTGCTTTGTGAAGGACATCTGGTTTTATAATAGCAAGAATTCCTACCACATAAATTTTGGGAGGTTTCCAAGACAGGCCCTGTGTCTGAATTTGGTTCATGGTGGCAAACTTTTTCGTACAATGTTGGCAAATATAAAAAAGATTTGCAAAACAAATTGTTGGAAACAAAAAAAAAAAACAAAAAGAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTAGTAGGTTCTTGAATAATAAC