ORFeome > nmnat1 ORF1 – XORFeome v1.0

nmnat1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nmnat1
Gene ID: 993373
Gene Page ID: 993367
ORF Xenbase ID: 17286531

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129707
Original XGC clone length: 837

Human orthology & disease relationships

NCBI Entrez ID: 64802
Ensembl gene IDs: ENSG00000173614
Directly associated (OMIM) disease MIM numbers: 608553
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,108500,124200,170400,208000,240600,266120,601003,601382,601887,602475,603041,609560,609909

Library Location

Plate ID: GDExl11091
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ838617
dbEST ID: 79656319
Trimmed Sequence: ATGGAAAAATCAGATGACAGGACAGAGGTTGTGTTACTGGCCACTGGCTCTTTTAACCCAATCACAGTTATGCATCTCAGGCTGTTTGAACTTGCAAGAGACTATCTGCATGACACAGGTAAATACAAAGTAATAAAAGGCATCATTTCTCCTGTTTGTGATGGGTACAAGAAGAAAGGCTTAATCGAGGCCTCTCACCGTCTAGCCATGGCAAACCTGGCTACCAAGACTTCAGACTGGTTGGAGGTGGATTCATGGGAATGCTCGCAGAAACAATGGACAGAAACTGTATTAGTGCTCAGGCATCACCAGCAAAAACTTACAAATGCAAATATTGTGGACACATGGGAGAAAGATGCACACAAGAAGGGACACAAGCGGAAAAGAGAGAATAGCCACCAAGATAAGCCTAACAGTTATCTACAAGAAAACAAAGCTGTGCCCCAGGTAAAGCTTCTCTGTGGAGCAGACATGCTTGAGTCACTTGGCAAACCCAACCTTTGGAAAAATGAAGATGTGATTGAGATTCTGTCTTCCTTTGGGATCATTTGCATCACCAGGCTTGGAAGCCATGCTAGTAATTTCATTTATGAGTCTGATATTCTCCGGAAGTAATAACCTATGATTCATCCAGTGGAAAAATGGAACAACCATTGAATTTTCCTCCACAAAGAATCCGAAAACCCTGTAAAAGGGGAAAGAAGTATCGCGCTATCAAATGCCTGAACGGGGGTGGGGAAATGAATTTTGAAAAACCTTGAAATTTATATAATGGAGAGGAAAA
Full Trace Sequence: CTCGAGGCCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAAAATCAGATGACAGGACAGAGGTTGTGTTACTGGCCACTGGCTCTTTTAACCCAATCACAGTTATGCATCTCAGGCTGTTTGAACTTGCAAGAGACTATCTGCATGACACAGGTAAATACAAAGTAATAAAAGGCATCATTTCTCCTGTTTGTGATGGGTACAAGAAGAAAGGCTTAATCGAGGCCTCTCACCGTCTAGCCATGGCAAACCTGGCTACCAAGACTTCAGACTGGTTGGAGGTGGATTCATGGGAATGCTCGCAGAAACAATGGACAGAAACTGTATTAGTGCTCAGGCATCACCAGCAAAAACTTACAAATGCAAATATTGTGGACACATGGGAGAAAGATGCACACAAGAAGGGACACAAGCGGAAAAGAGAGAATAGCCACCAAGATAAGCCTAACAGTTATCTACAAGAAAACAAAGCTGTGCCCCAGGTAAAGCTTCTCTGTGGAGCAGACATGCTTGAGTCACTTGGCAAACCCAACCTTTGGAAAAATGAAGATGTGATTGAGATTCTGTCTTCCTTTGGGATCATTTGCATCACCAGGCTTGGAAGCCATGCTAGTAATTTCATTTATGAGTCTGATATTCTCCGGAAGTAATAACCTATGATTCATCCAGTGGAAAAATGGAACAACCATTGAATTTTCCTCCACAAAGAATCCGAAAACCCTGTAAAAGGGGAAAGAAGTATCGCGCTATCAAATGCCTGAACGGGGGTGGGGAAATGAATTTTGAAAAACCTTGAAATTTATATAATGGAGAGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAAATCAGATGACAGGAC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGTAATCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACCAAAAAGTTGGCAAAAGCTGAAAATCCTTGGTATTTCCTGGAAGAAGGTCCAGGAATACCCCCCAATTCCTTTCCTCACTTTCCTCACTAAATAATTCATGAATTTGAATGGACTCCACCACACTGGCCGGGACTAAAAAGCGGAAACTCCTTCCCCTTCCCAAGGGTCTGCCAATCCTTGTAAAAGAAATGGCATTGGTGAACCACTCCTCCACTAAAAGAATCATAAGCTTATACCTCCCGAAAAAAACAAAATCATAAATGAAATTACTAACATTGCTTCCCAACCCGGTGATGCCAATGAACCCCAAGGAAGAAAAAATCTCCATCACATCTTCCTTTTTCCCAAAGTTGGGTTTGCCCAGTGACTCCAGCATGTCCGCTCCACAAAAAAACTTTACCTGGGGGACAACTTTGTTTTCCTGTAAAAAACTGGTAAGCTTAACTTGGTGGGCAATCCCTCCTTTCCGCTTGGGGCCCCTCCTGGGTGCCTCTTTCTCCCCTGTGGCCACAATAATTGCATTTGTAAGTTTTTGCTGGTGAAGCCTGAACACTAATAACATTTCCGTCCATTGGTTCGGCCAGCACTTCCCTGAAATCCCCTCCCACCCTTCTTAAATCCTGGTAACCAGGGTTTGCATGGCCAAAACGGGAAAAGGGCGCCCGTAAAACCCTTCTTCCTTGTTCCCCTTCAGAAACCGGAGAAAAAAGAGCCCTTTTTTTACTTTTTAATTTTTCTTTGTGTCATGGCAAAAATGTTCTTCTTGGCGGGTTTCAAAAACACCCCCGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGCTGAGAGTCCTTGGT