ORFeome > nmt2 ORF1 – XORFeome v1.0

nmt2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nmt2
Gene ID: 953055
Gene Page ID: 953050
ORF Xenbase ID: 17286549

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041300
Original XGC clone length: 1455

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ823635
dbEST ID: 79641337
Trimmed Sequence: ATGGCGGACCAGAGTGAGACAGCAGCGGGTGATCGGCTTGAGGAGGATGAAAACGGACACGGACACTGCAGCGACTGCGAAAATGAGGAGAAGCACAGCTCTAACAGAGGTTTTGGCGACGAGAGTGGAGGGAAGAAGAAAAAGAAGCAAAAGCGGAAGAAAGAAAAGAGCGGAGGAGATGCACTAGAAGCTGCCGAAGCCCCGGCGAACACACTGCCTGCTGAGAGAATCCAAGAAATCCAGAAGGCCATCGAGTTGTTTTCTGTTGGCCAAGGACCTGCTAAGACAATGGAGGAGGCGAGCAAGAGAAGTTACCAGTTCTGGGACACCCAGCCCGTCCCTAAGCTTGGAGAAGTGGTGAGCTCACACGGCCCCATTGAGCCAGATAAGGACAATATCCGCCAGGAGCCATATACCCTCCCACAGGGCTTCATCTGGGATGCTCTGGACTTGGGGGACAGGGTGGTGCTGAAGGAACTTTACACTCTACTTAATGAGAACTACGTGGAAGATGACGACAACATGTTCCGATTTGATTACTCCCCTGAATTCCTGCTCTGGGCACTGAGACCTCCTGGTTGGTTGCCCCAGTGGCACTGTGGTGTAAGAGTGATGTCTAGTAAGAAGCTGGTGGGATTTATTAGTGCTGTCCCAGCTTCAATGCATCTCTATGACATAACCAAAAAAATGGTCGAGATCAACTTCCTCTGTGTCCACAAGAAACTGCGCCTCAAAGAGGGTGGCCCCCCCTTTCTTATCCGGCGAAGATCAACGCGCCCGCGTTCAACCCTCCAAGGGAAAATCTTTTCCAGGGCCCCGTCTTA
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGACCAGAGTGAGACAGCAGCGGGTGATCGGCTTGAGGAGGATGAAAACGGACACGGACACTGCAGCGACTGCGAAAATGAGGAGAAGCACAGCTCTAACAGAGGTTTTGGCGACGAGAGTGGAGGGAAGAAGAAAAAGAAGCAAAAGCGGAAGAAAGAAAAGAGCGGAGGAGATGCACTAGAAGCTGCCGAAGCCCCGGCGAACACACTGCCTGCTGAGAGAATCCAAGAAATCCAGAAGGCCATCGAGTTGTTTTCTGTTGGCCAAGGACCTGCTAAGACAATGGAGGAGGCGAGCAAGAGAAGTTACCAGTTCTGGGACACCCAGCCCGTCCCTAAGCTTGGAGAAGTGGTGAGCTCACACGGCCCCATTGAGCCAGATAAGGACAATATCCGCCAGGAGCCATATACCCTCCCACAGGGCTTCATCTGGGATGCTCTGGACTTGGGGGACAGGGTGGTGCTGAAGGAACTTTACACTCTACTTAATGAGAACTACGTGGAAGATGACGACAACATGTTCCGATTTGATTACTCCCCTGAATTCCTGCTCTGGGCACTGAGACCTCCTGGTTGGTTGCCCCAGTGGCACTGTGGTGTAAGAGTGATGTCTAGTAAGAAGCTGGTGGGATTTATTAGTGCTGTCCCAGCTTCAATGCATCTCTATGACATAACCAAAAAAATGGTCGAGATCAACTTCCTCTGTGTCCACAAGAAACTGCGCCTCAAAGAGGGTGGCCCCCCCTTTCTTATCCGGCGAAGATCAACGCGCCCGCGTTCAACCCTCCAAGGGAAAATCTTTTCCAGGGCCCCGTCTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGACCAGAGTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ828940
dbEST ID: 79646642
Trimmed Sequence: CTGTAGAACCAGACCCACCTTCTCAGCCCCCATGCTGGGACATTTCCAATTATACAGGTAATACTGCAGATTTCCATCCCCAATACCAAACTTCAGCTTCTCCAAAAACGTTTTGTTCTCCATGAGGTCGAGAGCATTAAACACGTCAAACCCTTTAGATTTAGCCAATATCAGTGCATCGTTCATGAGGTCGACGAGAGGAGCCTTGGTGTGAACGCTGTAGAAGGAGTAGGCGGCTTTCAGGCTCTTGTGAGTCGGGTGGTTCATGATGGTGGAGGGGAGAGTGTAGAAGCTCAGGAAGTCCGTCAGCTCGCCCTCTGGTGTCTCCACTACAAATGTGTCAATGATGTTCTCCTGGGGGAGCAGCCAATGCCGGACCTCCTCCTCATCCATGACGGGGGCCAGGTTAAACTGCGAGAGATATTGAGACAGAAGCTTCTGCACAGCAGGGATGTGCCGGACTTCCATGGGCTTCAGGCCGGATGTTTTAGGAGTCTCAGGCAGTCGATACAACTTCATGGTTCTTTGCATGGTCATGTTACGGCTAAGGTGAGAGAATTTCACCTCGATCAGCTTGCGTGGGTTCAGCGATCTGTGCCAGTACCTGCAGGTAGCTACAGGTTTGGGCAGTACCACCCCAGCTGTGTAGACGGCCTGGAAGTTCCCCTCGAAGGTGGACGCGGCGCGTTGATCTCGCCGGATAAGAACGGGGGGCCACCCTCTTGGGAGCGGCAATTTCTTTGGGGAAACCAGAAAGAAATTTTGAATC
Full Trace Sequence: GGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGTAGAACCAGACCCACCTTCTCAGCCCCCATGCTGGGACATTTCCAATTATACAGGTAATACTGCAGATTTCCATCCCCAATACCAAACTTCAGCTTCTCCAAAAACGTTTTGTTCTCCATGAGGTCGAGAGCATTAAACACGTCAAACCCTTTAGATTTAGCCAATATCAGTGCATCGTTCATGAGGTCGACGAGAGGAGCCTTGGTGTGAACGCTGTAGAAGGAGTAGGCGGCTTTCAGGCTCTTGTGAGTCGGGTGGTTCATGATGGTGGAGGGGAGAGTGTAGAAGCTCAGGAAGTCCGTCAGCTCGCCCTCTGGTGTCTCCACTACAAATGTGTCAATGATGTTCTCCTGGGGGAGCAGCCAATGCCGGACCTCCTCCTCATCCATGACGGGGGCCAGGTTAAACTGCGAGAGATATTGAGACAGAAGCTTCTGCACAGCAGGGATGTGCCGGACTTCCATGGGCTTCAGGCCGGATGTTTTAGGAGTCTCAGGCAGTCGATACAACTTCATGGTTCTTTGCATGGTCATGTTACGGCTAAGGTGAGAGAATTTCACCTCGATCAGCTTGCGTGGGTTCAGCGATCTGTGCCAGTACCTGCAGGTAGCTACAGGTTTGGGCAGTACCACCCCAGCTGTGTAGACGGCCTGGAAGTTCCCCTCGAAGGTGGACGCGGCGCGTTGATCTCGCCGGATAAGAACGGGGGGCCACCCTCTTGGGAGCGGCAATTTCTTTGGGGAAACCAGAAAGAAATTTTGAATC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGTAGAACCAGACCCACC