ORFeome > nnmt ORF1 – XORFeome v1.0

nnmt ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nnmt
Gene ID: 6487754
Gene Page ID: 5884306
ORF Xenbase ID: 17286555

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053814
Original XGC clone length: 798

Human orthology & disease relationships

NCBI Entrez ID: 4837
Ensembl gene IDs: ENSG00000166741
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,102700,108500,124200,170400,208000,266120,278300,300322,300323,600462,601003,601382,601887,602475,605258,609909

Library Location

Plate ID: GDExl11001
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ839231
dbEST ID: 79656933
Trimmed Sequence: ATGGCTACTGAATTCACAGGCAAAGACATTTATCAGGAGGAATTTGATCCTTGGGGTTATTTGGATACATACTATAACCTAAAATCTGGCATTCTGGTGACAGATGGATTTCTGGATTTTGCTTTGAGAAAACTTCATGAAACATTCACCGTGCGTGGAGTGAAGGGAGAGACACTTATTGACATTGGCCATGGCCCAACAATTTATCAGGACCTTTCTGCATGTGAATCATTCAAAGAGATCATTGGTGCTGACTATGCTGACTGTAGCCGTGAGTACTATGAAAAATCTGTGAAGAATGAGCCAGGAATATTTGACTGGACAACTGTTATACAAGCAGTCTGTGACCTGGAGGGAAAGGGAACAGTGGAAGAGAAGAGAGAAAAACTAAAAAGGACAGTGAAAAAGTCTATCAAATGTGATGTAACGAAGAGCAGTCCTGTGGCACCTCTGGTGTTGCCCAGAGTTGACTGTATAATGACTCTTGGATGCCTGGAATGTGCCTGTAAAGATCTGGATAGTTACCGTAATGTACTTAAAAACATTTCATCTTTGCTAAAAGTGGGGGGGGAATTTAATCATTACCGAGATTCTTAACTGTACCTCCTACTTGTCTGGAGGGCAAAGGTTTTCTTGTTTATCCTTAAATGAACCGTTAATGAGAAATGCTATAACTGGAGGCTGGCTTTGCCTATTATAAACCTGGGAGGTAATATTCAGAAAGTAAGAACAAAGAGCCATAAAAAAACCCTGTAATCCTGGAACTTAAGCCTTGGTTTGTT
Full Trace Sequence: GCTCGCGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTACTGAATTCACAGGCAAAGACATTTATCAGGAGGAATTTGATCCTTGGGGTTATTTGGATACATACTATAACCTAAAATCTGGCATTCTGGTGACAGATGGATTTCTGGATTTTGCTTTGAGAAAACTTCATGAAACATTCACCGTGCGTGGAGTGAAGGGAGAGACACTTATTGACATTGGCCATGGCCCAACAATTTATCAGGACCTTTCTGCATGTGAATCATTCAAAGAGATCATTGGTGCTGACTATGCTGACTGTAGCCGTGAGTACTATGAAAAATCTGTGAAGAATGAGCCAGGAATATTTGACTGGACAACTGTTATACAAGCAGTCTGTGACCTGGAGGGAAAGGGAACAGTGGAAGAGAAGAGAGAAAAACTAAAAAGGACAGTGAAAAAGTCTATCAAATGTGATGTAACGAAGAGCAGTCCTGTGGCACCTCTGGTGTTGCCCAGAGTTGACTGTATAATGACTCTTGGATGCCTGGAATGTGCCTGTAAAGATCTGGATAGTTACCGTAATGTACTTAAAAACATTTCATCTTTGCTAAAAGTGGGGGGGGAATTTAATCATTACCGAGATTCTTAACTGTACCTCCTACTTGTCTGGAGGGCAAAGGTTTTCTTGTTTATCCTTAAATGAACCGTTAATGAGAAATGCTATAACTGGAGGCTGGCTTTGCCTATTATAAACCTGGGAGGTAATATTCAGAAAGTAAGAACAAAGAGCCATAAAAAAACCCTGTAATCCTGGAACTTAAGCCTTGGTTTGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACTGAATTCACAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839230
dbEST ID: 79656932
Trimmed Sequence: AATATCCCTCAGTTTGCGTGCAAGAACAAACAAGCTTGAGTCATGATTACAGGTATTGTACTGCTCTTTGTCATACTTTCTGAATATAACCTCCAGGTCTATTATAGCAAAGCCAGCCTCAGTTATAGCACTTCTCATAAACGGTTCATTTAAGGATAAACAAGAAAACCTTTTGCCTCCAGACAAGTAGGAGGTACAGTTAAGAATCTCGGTAATGATTAAATTCCCCCCCACTTTTAGCAAAGATGAAATGTTTTTAAGTACATTACGGTAACTATCCAGATCTTTACAGGCACATTCCAGGCATCCAAGAGTCATTATACAGTCAACTCTGGGCAACACCAGAGGTGCCACAGGACTGCTCTTCGTTACATCACATTTGATAGACTTTTTCACTGTCCTTTTTAGTTTTTCTCTCTTCTCTTCCACTGTTCCCTTTCCCTCCAGGTCACAGACTGCTTGTATAACAGTTGTCCAGTCAAATATTCCTGGCTCATTCTTCACAGATTTTTCATAGTACTCACGGCTACAGTCAGCAAAGTCAGCACCAATGATCTCTTTGAATGATTCACATGCAGAAAGGTCCTGATAAATTTGTTGGGCCAGGGGCCATGTCAATAAGTTGTCTCTTCCCTTCCCTCCACGCAACGGGGGAAGGGTTCCATGAAAATTTTTCCTCAAGACAAAATTCCAAAAATCCCATCCTGTTCACCCAAAAAGCCCCAAAATTTTTAGGGTTTATAAGTAAGGTTAATTCCAAAAAAAC
Full Trace Sequence: GACGGGAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATATCCCTCAGTTTGCGTGCAAGAACAAACAAGCTTGAGTCATGATTACAGGTATTGTACTGCTCTTTGTCATACTTTCTGAATATAACCTCCAGGTCTATTATAGCAAAGCCAGCCTCAGTTATAGCACTTCTCATAAACGGTTCATTTAAGGATAAACAAGAAAACCTTTTGCCTCCAGACAAGTAGGAGGTACAGTTAAGAATCTCGGTAATGATTAAATTCCCCCCCACTTTTAGCAAAGATGAAATGTTTTTAAGTACATTACGGTAACTATCCAGATCTTTACAGGCACATTCCAGGCATCCAAGAGTCATTATACAGTCAACTCTGGGCAACACCAGAGGTGCCACAGGACTGCTCTTCGTTACATCACATTTGATAGACTTTTTCACTGTCCTTTTTAGTTTTTCTCTCTTCTCTTCCACTGTTCCCTTTCCCTCCAGGTCACAGACTGCTTGTATAACAGTTGTCCAGTCAAATATTCCTGGCTCATTCTTCACAGATTTTTCATAGTACTCACGGCTACAGTCAGCAAAGTCAGCACCAATGATCTCTTTGAATGATTCACATGCAGAAAGGTCCTGATAAATTTGTTGGGCCAGGGGCCATGTCAATAAGTTGTCTCTTCCCTTCCCTCCACGCAACGGGGGAAGGGTTCCATGAAAATTTTTCCTCAAGACAAAATTCCAAAAATCCCATCCTGTTCACCCAAAAAGCCCCAAAATTTTTAGGGTTTATAAGTAAGGTTAATTCCAAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATATCCCTCAGTTTGCGTG