ORFeome > nol11 ORF1 – XORFeome v1.0

nol11 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255980
Gene Page ID:
ORF Xenbase ID: 17286591

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108774
Original XGC clone length: 2163

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ837711
dbEST ID: 79655413
Trimmed Sequence: ATGGCCGCTCTCAGTGAGCACTTCACGTTGTGCGGACTTCTTACCGGGACCGATGACGGAAAAAGCGAGATACTTGGGGTGGAACCAGCAGGGGAGCCAGACAGGGTGTTGGTGACGGACTCTGTACAGGCTGTAACTTTGTATAAGGTCTCTGATCAGAAGCCACAAGGAGCATGGGCAGTAAAACAAGGACAAAGCATTACCTGCCCAGCTGTATTGAATCCTGAATCTGGAGAATTTATTGTTGTTCATGATGACAAGGTTTTAAGAATATGGAAAGAAGATAATGTGAATTTGGATATTGCTTTTAAAGCCACACTTTCCGCTGATGTCTGTCGAATCCATACTCTCCCTAATACCGATCCACTTGTGCTGTTCAAAGGAGGAGCCGTCCACTTCTTAGACTCTTTACTCACTGACCCCCAGCAGAAAATTGGAACTGTTCTTTCAGATGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCAGATGATGGACAGCCTCTCATAGTCTATCTTACACAGCAGTTCTCCAATTATTTTGTGTACATTCACAAGTTCAGTCCAGTTTGTGTTTGTAAATATCATCTTAAACCAAACACAGAAGATTCCACTATCCTGGACTGTTCCGGGTCTGTGAAAAGTAAAATATTCACTCTTCTTACTTTGTACTCTAGTGGGCAAGTTTGCCAGAATCCATTCCCAGTGTTCCTCATTAACAAGGGAAACAAAGAAGGGTGGTTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGCTCTCAGTGAGCACTTCACGTTGTGCGGACTTCTTACCGGGACCGATGACGGAAAAAGCGAGATACTTGGGGTGGAACCAGCAGGGGAGCCAGACAGGGTGTTGGTGACGGACTCTGTACAGGCTGTAACTTTGTATAAGGTCTCTGATCAGAAGCCACAAGGAGCATGGGCAGTAAAACAAGGACAAAGCATTACCTGCCCAGCTGTATTGAATCCTGAATCTGGAGAATTTATTGTTGTTCATGATGACAAGGTTTTAAGAATATGGAAAGAAGATAATGTGAATTTGGATATTGCTTTTAAAGCCACACTTTCCGCTGATGTCTGTCGAATCCATACTCTCCCTAATACCGATCCACTTGTGCTGTTCAAAGGAGGAGCCGTCCACTTCTTAGACTCTTTACTCACTGACCCCCAGCAGAAAATTGGAACTGTTCTTTCAGATGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCAGATGATGGACAGCCTCTCATAGTCTATCTTACACAGCAGTTCTCCAATTATTTTGTGTACATTCACAAGTTCAGTCCAGTTTGTGTTTGTAAATATCATCTTAAACCAAACACAGAAGATTCCACTATCCTGGACTGTTCCGGGTCTGTGAAAAGTAAAATATTCACTCTTCTTACTTTGTACTCTAGTGGGCAAGTTTGCCAGAATCCATTCCCAGTGTTCCTCATTAACAAGGGAAACAAAGAAGGGTGGTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGCTCTCAGTGAGCACTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837710
dbEST ID: 79655412
Trimmed Sequence: GTAGAGTTGGAGCACTTCTATTGGTCCAGACAGTTGCAAAAGCGGTGATGCTGAAACAACCCTCTCTGTTTCCTTGTTAATGAGTGACACTGGGAATGGAGTCTGGCAAACTTGCCCACTAGAGTACAAAGTAAGAAGAGTGAATATTTTACTTTTCACAGACCCGGAACAGTCCAGGATAGTGGAATCTTCTGTGTTTGGTTTAAGATGATATTTACAAACACAAACTGGACTGAACTTGTGAATGTACACAAAATAATTGGAGAACTGCTGTGTAAGATAGACTATGAGAGGCTGTCCATCATCTGCAAAGATCTCTGACCACACAATCCTCTCTCCATCTGAAAGAACAGTTCCAATTTTCTGCTGGGGGTCAGTGAGTAAAGAGTCTAAGAAGTGGACGGCTCCTCCTTTGAACAGCACAAGTGGATCGGTATTAGGGAGAGTATGGATTCGACAGACATCAGCGGAAAGTGTGGCTTTAAAAGCAATATCCAAATTCACATTATCTTCTTTCCATATTCTTAAAACCTTGTCATCATGAACAACAATAAATTCTCCAGATTCAGGATTCAGTACAGCTGGGCAGGTAATGCTTTGTCCTTGTTTTACTGCCCATGCTCCTTGTGGCTTCTGATCAGAGACCTTATACAAAGTTACAGCCTGTACAGAGTCCGTCACCAACACCCTGTCTGGCTCCCCGGCTGGTTCCACCCCAAGTATCTCGCTTTTTCCGTCATCGGTCCCGGTAAGAAGTCCGCACAACGTGAAATGCGCACTGAGAACGGCCATGG
Full Trace Sequence: GGGACGGGTAATCAGCTTATGACCATGTACAACGACTCACTATACGGGGAAACCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGAGTTGGAGCACTTCTATTGGTCCAGACAGTTGCAAAAGCGGTGATGCTGAAACAACCCTCTCTGTTTCCTTGTTAATGAGTGACACTGGGAATGGAGTCTGGCAAACTTGCCCACTAGAGTACAAAGTAAGAAGAGTGAATATTTTACTTTTCACAGACCCGGAACAGTCCAGGATAGTGGAATCTTCTGTGTTTGGTTTAAGATGATATTTACAAACACAAACTGGACTGAACTTGTGAATGTACACAAAATAATTGGAGAACTGCTGTGTAAGATAGACTATGAGAGGCTGTCCATCATCTGCAAAGATCTCTGACCACACAATCCTCTCTCCATCTGAAAGAACAGTTCCAATTTTCTGCTGGGGGTCAGTGAGTAAAGAGTCTAAGAAGTGGACGGCTCCTCCTTTGAACAGCACAAGTGGATCGGTATTAGGGAGAGTATGGATTCGACAGACATCAGCGGAAAGTGTGGCTTTAAAAGCAATATCCAAATTCACATTATCTTCTTTCCATATTCTTAAAACCTTGTCATCATGAACAACAATAAATTCTCCAGATTCAGGATTCAGTACAGCTGGGCAGGTAATGCTTTGTCCTTGTTTTACTGCCCATGCTCCTTGTGGCTTCTGATCAGAGACCTTATACAAAGTTACAGCCTGTACAGAGTCCGTCACCAACACCCTGTCTGGCTCCCCGGCTGGTTCCACCCCAAGTATCTCGCTTTTTCCGTCATCGGTCCCGGTAAGAAGTCCGCACAACGTGAAATGCGCACTGAGAACGGCCATGGTGCCAACTTTTTTGTACAAAGTTTGGCATTAAAAAAAACCATTGTTCATAATTTGGTGCAACCAAGAGGTTAATAATCATTCCAAATGAAAAAAAAAATAAAAGGACCCAAGCGTAAAAAATGGGCCCTGTTTTTAACAGCAACCCGGAAATGGGAAAAAGCCCCACGGGCCAAGGAGGGAAGCAGGGGGTATGTTAAGTAAACTAATGGGGGAAAAGAAAAACAAACAAACACAAAGAGAAGAAGAGAGGGTGGGGGGGGATAAAGAGAGTGAAGAGAGAGAGAAGGAGGAGCCAGGGGCCGCGACCGCGGACAAGGCGAAACGCTGGTAGNTGCGGGCGGAGGNGAGGAGAGGAAGGGAAGAAAGGAAGAGGGGGAGGGGGGGGTGGGTTNNTAAGTTNTTTGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGAGTTGGAGCACTTCTAT