ORFeome > nop58 ORF2 – XORFeome v1.0

nop58 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nop58
Gene ID: 990563
Gene Page ID: 990555
ORF Xenbase ID: 17286645

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122512
Original XGC clone length: 1605

Human orthology & disease relationships

NCBI Entrez ID: 51602
Ensembl gene IDs: ENSG00000055044
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 137760,300240,305000,604901,609887

Library Location

Plate ID: GDExl11087
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ838180
dbEST ID: 79655882
Trimmed Sequence: ATGCTGGTGCTATTCGAAACAGCGGCGGGTTACGCCATTTTCAAGGTTCTGGACGAGAGCAAGCTGCAGGAAGTAGACAGCATATGGAAAGAGTTTGAAACACCAGAAAAAGCGAATAAAGTGGTGAAATTAAAACACTTTGAGAAGTTTCAGGACACAACAGAAGCATTGGCAGCTTCCACGGCTCTGGTTGAAGGAAAAATTGGCAAAAATTTGAAGAAAGTCTTAAGAAAAATTGCAGCAAAGGAGGCTCATGAGCAACTTGCAATTGCAGATGCAAAACTTGGTGGTGTCATCAAGGACAAAGTCAATATCAGCTGTGTTCATACTTCCATGGTAACAGAACTAATGAGAGGAATCCGCAACCAGGTAGATGGTTTAATAACAGGGATTTCATCACGTGAAATGGCAGCCATGTCTCTTGGTTTGGCTCATAGTCTTTCCCGGTACAAACTGAAATTCAGCCCTGATAAAGTGGATACAATGATAGTCCAAGCCATATCACTACTTGATGATTTGGATAAAGAGCTTAACAATTATATAATGCGCTGCGGAGAGGGG
Full Trace Sequence: TTGGCTCGGGGCCCAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGGTGCTATTCGAAACAGCGGCGGGTTACGCCATTTTCAAGGTTCTGGACGAGAGCAAGCTGCAGGAAGTAGACAGCATATGGAAAGAGTTTGAAACACCAGAAAAAGCGAATAAAGTGGTGAAATTAAAACACTTTGAGAAGTTTCAGGACACAACAGAAGCATTGGCAGCTTCCACGGCTCTGGTTGAAGGAAAAATTGGCAAAAATTTGAAGAAAGTCTTAAGAAAAATTGCAGCAAAGGAGGCTCATGAGCAACTTGCAATTGCAGATGCAAAACTTGGTGGTGTCATCAAGGACAAAGTCAATATCAGCTGTGTTCATACTTCCATGGTAACAGAACTAATGAGAGGAATCCGCAACCAGGTAGATGGTTTAATAACAGGGATTTCATCACGTGAAATGGCAGCCATGTCTCTTGGTTTGGCTCATAGTCTTTCCCGGTACAAACTGAAATTCAGCCCTGATAAAGTGGATACAATGATAGTCCAAGCCATATCACTACTTGATGATTTGGATAAAGAGCTTAACAATTATATAATGCGCTGCGGAGAGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGTGCTATTCGAAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838179
dbEST ID: 79655881
Trimmed Sequence: CTCATCCTCCTCCTGTTTCACCTTCTTCTTCTTCTTCTTCTTCTTTTTTGGAGTCTCAGCTGCTGTGCTGGTTGAAGGTTCTTCCTCTTCTACTTCTACCTCTACTGCCTCTGCCTCTTCCTCCTCAACTTTGATCTTCTTCTTCTTCTTTTTCTTCTTTGGAGTTTCTTCCTCTATTTCCTCTTCTTCCTGCACTACCTCCACTTTGGCTTTTTTAGCTTTAACCTTAATTTCTGTTGGTTGCTCTTCTTCTTCTACCTCCTCAAACTTTCTCTTCTTTGGAACAGCTGGCAGTGTAGAATCTCCAGAAGGATCATATGTCCGTACTTCACTCTTGTGCTGATACTTTTCTGCTCTGGCTAATGCTTTCCCAGTGCCACTGATTCTTTTCAACCCCTTCTCTTCCAGGTGTCTGAGACGTGACTCCAGCTTAGCTCTGGTTTCCACACCCAATTCTGCATTTGTGTCTTCTCCAAGAGCATCATATCGTATGGCAAGGGCTGCCTTGGCTGCCAACATACAGGAAATCTTGCCCTTATTTTTGGGGGTAGTCTGTCCAACTAAAGAAACATGATAAATCAGCCCATAATTTGGGGGTGTCCTTTCTGGTTTTTAATGCTCTGAAAAGAACTTTCTCTGCTCCCAAAATCTGGACAGTTGATGCAAAAATCTTTTGCTAATTTCAAAAGGA
Full Trace Sequence: CGTGTAAACCGCTTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCATCCTCCTCCTGTTTCACCTTCTTCTTCTTCTTCTTCTTCTTTTTTGGAGTCTCAGCTGCTGTGCTGGTTGAAGGTTCTTCCTCTTCTACTTCTACCTCTACTGCCTCTGCCTCTTCCTCCTCAACTTTGATCTTCTTCTTCTTCTTTTTCTTCTTTGGAGTTTCTTCCTCTATTTCCTCTTCTTCCTGCACTACCTCCACTTTGGCTTTTTTAGCTTTAACCTTAATTTCTGTTGGTTGCTCTTCTTCTTCTACCTCCTCAAACTTTCTCTTCTTTGGAACAGCTGGCAGTGTAGAATCTCCAGAAGGATCATATGTCCGTACTTCACTCTTGTGCTGATACTTTTCTGCTCTGGCTAATGCTTTCCCAGTGCCACTGATTCTTTTCAACCCCTTCTCTTCCAGGTGTCTGAGACGTGACTCCAGCTTAGCTCTGGTTTCCACACCCAATTCTGCATTTGTGTCTTCTCCAAGAGCATCATATCGTATGGCAAGGGCTGCCTTGGCTGCCAACATACAGGAAATCTTGCCCTTATTTTTGGGGGTAGTCTGTCCAACTAAAGAAACATGATAAATCAGCCCATAATTTGGGGGTGTCCTTTCTGGTTTTTAATGCTCTGAAAAGAACTTTCTCTGCTCCCAAAATCTGGACAGTTGATGCAAAAATCTTTTGCTAATTTCAAAAGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCATCCTCCTCCTGTTT