ORFeome > not ORF1 – XORFeome v1.0

not ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: not
Gene ID: 865187
Gene Page ID: 478517
ORF Xenbase ID: 17286663

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC123237
Original XGC clone length: 642

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ838249
dbEST ID: 79655951
Trimmed Sequence: ATGGAGTTGCCCAGGACCCCAAAGGCTTCCTTCAACATTGACTCCATCCTCTCCAGAACAGACAGACCTGCCTCCAAACTATCCATGGAGATGCCCAGCTGGCAGCCCCCTTCTCCCCCATCTATGCCCTACCGCTACTCATATGGAATGATGCCCTACCCACCCGTGTGGCTCATCAAACCCACAGTGGGCTACCCCAACATGGCACAACAGCAGCCAATGAGGATGCCCAGGGGAGAATGTCTGTGTCCAGACCCTACCTGTAAAGAGAGAGTATTGCCATTCTCCCACTGCCCAAATGGTGCCATGAACCCCCTCTCGTGGAGGACAGGACCCTGCAAGATGAAGAGAATCCGCACAGTGTTCACCCCAGAGCAGCTGGAGAAGCTGGAGAAGGAGTTTCTCAAACAGCAATACATGGTTGGCACTGAAAGGGTGGACCTGGCATCTACACTCAACCTCACAGAAACACAGGTGAAAGTTTGGTTCCAGAACCGACGCATCAAGTGGAGGAAGCAGAGTCTGGAGCAGAAGAAAGCTAAGCTGTCCCATTTTGGGGTGATCCCTGCAGACAGCTCAGATCACACTGATGACAGCAGGGAGACTGAAGAGGACGAGGATGATCTGGATGTGGAACTGTT
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTTGCCCAGGACCCCAAAGGCTTCCTTCAACATTGACTCCATCCTCTCCAGAACAGACAGACCTGCCTCCAAACTATCCATGGAGATGCCCAGCTGGCAGCCCCCTTCTCCCCCATCTATGCCCTACCGCTACTCATATGGAATGATGCCCTACCCACCCGTGTGGCTCATCAAACCCACAGTGGGCTACCCCAACATGGCACAACAGCAGCCAATGAGGATGCCCAGGGGAGAATGTCTGTGTCCAGACCCTACCTGTAAAGAGAGAGTATTGCCATTCTCCCACTGCCCAAATGGTGCCATGAACCCCCTCTCGTGGAGGACAGGACCCTGCAAGATGAAGAGAATCCGCACAGTGTTCACCCCAGAGCAGCTGGAGAAGCTGGAGAAGGAGTTTCTCAAACAGCAATACATGGTTGGCACTGAAAGGGTGGACCTGGCATCTACACTCAACCTCACAGAAACACAGGTGAAAGTTTGGTTCCAGAACCGACGCATCAAGTGGAGGAAGCAGAGTCTGGAGCAGAAGAAAGCTAAGCTGTCCCATTTTGGGGTGATCCCTGCAGACAGCTCAGATCACACTGATGACAGCAGGGAGACTGAAGAGGACGAGGATGATCTGGATGTGGAACTGTTGCCAACTTCCTTGTACAAGTTGGCATTATAAAAAAGCATTGCTTATCATTTTGTTTGCAACGAACAGGGTCATTATTCAGTCAAAAAAAAAATCAATATTTTGCCCATCCCGCCTTAATTTCCCCCCCATAGAAAAAAAAAAAAAAAAAAAGAGAAAAAAAAAAACAGTATTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTTGCCCAGGACCCCAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838248
dbEST ID: 79655950
Trimmed Sequence: CAGTTCCACATCCAGATCATCCTCGTCCTCCTCAGTCTCCCTGCTGTCATCAGTGTGATCTGAGCTGTCTGCAGGGATCACCCCAAATTGGGACAGCTTAGCTTTCTTCTGCTCCAGACTCTGCTTCCTCCACTTGATGCGTCGGTTCTGGAACCAAACTTTCACCTGTGTTTCTGTGAGGTTGAGTGTAGATGCCAGGTCCACCCTTTCAGTGCCAACCATGTATTGCTGTTTGAGAAACTCCTTCTCCAGCTTCTCCAGCTGCTCTGGGGTGAACACTGTGCGGATTCTCTTCATCTTGCAGGGTCCTGTCCTCCACGAGAGGGGGTTCATGGCACCATTTGGGCAGTGGGAGAATGGCAATACTCTCTCTTTACAGGTAGGGTCTGGACACAGACATTCTCCCCTGGGCATCCTCATTGGCTGCTGTTGTGCCATGTTGGGGTAGCCCACTGTGGGTTTGATGAGCCACACGGGTGNGGTAGGGCATCATTCCATATCAGTACCGCTAGGGCATAGATGGGAGGAAAAGAGACCTGCGAGCTGGGCATCTCCGTGGATAGTTAGAAGGCAGGTGTGTCTGTTTTTGAAAGGGAGGAGTCAGTGATTAGTAAAACATTAAAAGATCTGGGCAACTCCATGGGGGCAGCTTTTGTTTGCGAGGGGGCAATAAAAAAGAGGATATGACTACGGGGTTGNNNNAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAGAAGGTGCAAGTCTCTTTTCCCTCCGCGGGG
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGTTCCACATCCAGATCATCCTCGTCCTCCTCAGTCTCCCTGCTGTCATCAGTGTGATCTGAGCTGTCTGCAGGGATCACCCCAAATTGGGACAGCTTAGCTTTCTTCTGCTCCAGACTCTGCTTCCTCCACTTGATGCGTCGGTTCTGGAACCAAACTTTCACCTGTGTTTCTGTGAGGTTGAGTGTAGATGCCAGGTCCACCCTTTCAGTGCCAACCATGTATTGCTGTTTGAGAAACTCCTTCTCCAGCTTCTCCAGCTGCTCTGGGGTGAACACTGTGCGGATTCTCTTCATCTTGCAGGGTCCTGTCCTCCACGAGAGGGGGTTCATGGCACCATTTGGGCAGTGGGAGAATGGCAATACTCTCTCTTTACAGGTAGGGTCTGGACACAGACATTCTCCCCTGGGCATCCTCATTGGCTGCTGTTGTGCCATGTTGGGGTAGCCCACTGTGGGTTTGATGAGCCACACGGGTGNGGTAGGGCATCATTCCATATCAGTACCGCTAGGGCATAGATGGGAGGAAAAGAGACCTGCGAGCTGGGCATCTCCGTGGATAGTTAGAAGGCAGGTGTGTCTGTTTTTGAAAGGGAGGAGTCAGTGATTAGTAAAACATTAAAAGATCTGGGCAACTCCATGGGGGCAGCTTTTGTTTGCGAGGGGGCAATAAAAAAGAGGATATGACTACGGGGTTGNNNNAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAGAAGGTGCAAGTCTCTTTTCCCTCCGCGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTTCCACATCCAGATCA