ORFeome > npc2 ORF1 – XORFeome v1.0

npc2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: npc2
Gene ID: 6254919
Gene Page ID: 6258063
ORF Xenbase ID: 17286699

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060392
Original XGC clone length: 453

Human orthology & disease relationships

NCBI Entrez ID: 10577
Ensembl gene IDs: ENSG00000119655
Directly associated (OMIM) disease MIM numbers: 607625
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11022
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ824776
dbEST ID: 79642478
Trimmed Sequence: ATGTGTTCAGGATTGCTGACAGTTCTGCTGACAGTCTTTCTTATACCAAGTTCAGTTCCAGAGCCCCTTGTCTACAAGGACTGTGGTAGCCAAAGTGGAAAGCTGACCCTTCTTGATGTGTCTCCTTGCCCAGAACAGCCATGTCCCCTGAAGCGAGGGGACACATACACCATTAATGCAACATTTATAAGCAATGTAAACAGTAAAAGTGCTACTGCTGTGGTACATGGAATCATTATGGGTATTCCTGCCCCCTTCCCAATCTCAGAACCAGATGGCTGTAAAACTGGTATATCCTGCCCAATCAACAGTGGGCAGACTTATACCTACCTCACCAAGTTGCCTATCAAGAGCGAGTATCCTTGTATCAAGCTTGTAGTGAAGTGGCAACTTCAGGATGAAAATAATCAGAATCTTTTCTGCTGGCTTCTCCCTGTTCATATTACGGATTT
Full Trace Sequence: AAGTACTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTTCAGGATTGCTGACAGTTCTGCTGACAGTCTTTCTTATACCAAGTTCAGTTCCAGAGCCCCTTGTCTACAAGGACTGTGGTAGCCAAAGTGGAAAGCTGACCCTTCTTGATGTGTCTCCTTGCCCAGAACAGCCATGTCCCCTGAAGCGAGGGGACACATACACCATTAATGCAACATTTATAAGCAATGTAAACAGTAAAAGTGCTACTGCTGTGGTACATGGAATCATTATGGGTATTCCTGCCCCCTTCCCAATCTCAGAACCAGATGGCTGTAAAACTGGTATATCCTGCCCAATCAACAGTGGGCAGACTTATACCTACCTCACCAAGTTGCCTATCAAGAGCGAGTATCCTTGTATCAAGCTTGTAGTGAAGTGGCAACTTCAGGATGAAAATAATCAGAATCTTTTCTGCTGGCTTCTCCCTGTTCATATTACGGATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCCAATACAAAATAAATGTTAAAACCNNGGNNGTTGCNTTCCCCTGCCTGGGGTCTCTCGGTTCCTTTTCTTGGGGTGGCTTGTTTGTTTCCCGCCTCCTGTGGGGTTGGCCCCTTCGGCGTCCCCCCTTCGGGCCCCCGGTCCCGGCGTCCGTGTGCCTGTCCGGGGGGGCTTTGCCTTTTCTTTTTCTGTCCTCTTGGCCCCCCCGTCTTTTTTTGGCGGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTTCAGGATTGCTGACAGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ830142
dbEST ID: 79647844
Trimmed Sequence: ATCCGTAATATGAACAGGGAGAAGCCAGCAGAAAAGATTCTGATTATTTTCATCCTGAAGTTGCCACTTCACTACAAGCTTGATACAAGGATACTCGCTCTTGATAGGCAACTTGGTGAGGTAGGTATAAGTCTGCCCACTGTTGATTGGGCAGGATATACCAGTTTTACAGCCATCTGGTTCTGAGATTGGGAAGGGGGCAGGAATACCCATAATGATTCCATGTACCACAGCAGTAGCACTTTTACTGTTTACATTGCTTATAAATGTTGCATTAATGGTGTATGTGTCCCCTCGCTTCAGGGGACATGGCTGTTCTGGGCAAGGAGACACATCAAGAAGGGTCAGCTTTCCACTTTGGCTACCACAGTCCTTGTAGACAAGGGGCTCTGGAACTGAACTTGGTATAAGAAAGACTGTCAGCAGAACTGTCAGCAATCCTGAACACATGG
Full Trace Sequence: ACGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCCGTAATATGAACAGGGAGAAGCCAGCAGAAAAGATTCTGATTATTTTCATCCTGAAGTTGCCACTTCACTACAAGCTTGATACAAGGATACTCGCTCTTGATAGGCAACTTGGTGAGGTAGGTATAAGTCTGCCCACTGTTGATTGGGCAGGATATACCAGTTTTACAGCCATCTGGTTCTGAGATTGGGAAGGGGGCAGGAATACCCATAATGATTCCATGTACCACAGCAGTAGCACTTTTACTGTTTACATTGCTTATAAATGTTGCATTAATGGTGTATGTGTCCCCTCGCTTCAGGGGACATGGCTGTTCTGGGCAAGGAGACACATCAAGAAGGGTCAGCTTTCCACTTTGGCTACCACAGTCCTTGTAGACAAGGGGCTCTGGAACTGAACTTGGTATAAGAAAGACTGTCAGCAGAACTGTCAGCAATCCTGAACACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTTGCACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTAAAGACTGGCCGTCGTTTCACAAANGGGAGAAGGGGGGAAATCCCGGAGACATTCCTGACCCTGGGTATCTAGGCTTGGGGTTTCTCCAATGCTTACCCGTTTGTGCAGGGAGGGAAAAGAAACACGTTTACATCCACATTTGAAGTTAAAAACCACGAACGAATTTCCCGGGCGCGTTTCCTACAACATTATATCGCTGAAAAGCCTCGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCGTAATATGAACAGGGAGAA