ORFeome > nprl2 ORF1 – XORFeome v1.0

nprl2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nprl2
Gene ID: 866566
Gene Page ID: 854703
ORF Xenbase ID: 17286783

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC041229
Original XGC clone length: 1137

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ823671
dbEST ID: 79641373
Trimmed Sequence: ATGGCCAACCGGAAGATCGAGTGCATTTTCTTCAGCGAGTTTCATCCAACTCATGGCACAAAGATAACCTACCAGGTTCCGGAGGAATACATTTTTCGAGAGCTGTTTGACTCCGTGCATGTGTATATCATTACCAAACATGAGCTGCAGAACAAACTAATCACAGTAACTGCCATGGACAAGAAGCTGATTGGTTGTCCTGTATGCATTGAGAACAAGAAATACAGTCGAAATGCTCTGCTCTTTAACCTGGGCTTTGTGTGTGATGCTCGAGCAAAGACGTGTGCTCTGGAGCCCATCGTGAAGAAGCTAGCGGGATATCTCACCACACTGGAGCTGGAAACTGGGTTTATCTCAAATGAAGATAGCAAACAGAGATTGGTGCCTATAATGAATATCTTACTGGAAGGCCTTAACTCCACGGGCGAATGTTCCCTCCCTATAGATGAGAGTAACACTATGCATTTGAAAGTGATTGAGCCTCGAGTGTCACCACCAACCGCACAGGAATACGATGTTCCTGTCTTTATTGAAGAGAAAGAGGATTTCAGTAATTCACAATGGGATTTAACCACTCAGCAGATCCTTCCATACATTGATGGTTTCCGTCACATCCAGAAGATTTCTGCAGAGGCTGATGTGGAACTGAACCTTGTGCGAATTGCAATCCAAACCTGATGTACTATGGAGTGGTTACATTAGTTTCAATATTTCAGTATTCCAATGTATATTGTACAACTCCACTGGGTGCATGAAGCTTATCCATGACAAAGCTTTTACAAGAGGGATTGTCTGGAACTACCCTGAAGTAAGCCAGGCCCTTAAAGCCGGGCCCC
Full Trace Sequence: TAATGAAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAACCGGAAGATCGAGTGCATTTTCTTCAGCGAGTTTCATCCAACTCATGGCACAAAGATAACCTACCAGGTTCCGGAGGAATACATTTTTCGAGAGCTGTTTGACTCCGTGCATGTGTATATCATTACCAAACATGAGCTGCAGAACAAACTAATCACAGTAACTGCCATGGACAAGAAGCTGATTGGTTGTCCTGTATGCATTGAGAACAAGAAATACAGTCGAAATGCTCTGCTCTTTAACCTGGGCTTTGTGTGTGATGCTCGAGCAAAGACGTGTGCTCTGGAGCCCATCGTGAAGAAGCTAGCGGGATATCTCACCACACTGGAGCTGGAAACTGGGTTTATCTCAAATGAAGATAGCAAACAGAGATTGGTGCCTATAATGAATATCTTACTGGAAGGCCTTAACTCCACGGGCGAATGTTCCCTCCCTATAGATGAGAGTAACACTATGCATTTGAAAGTGATTGAGCCTCGAGTGTCACCACCAACCGCACAGGAATACGATGTTCCTGTCTTTATTGAAGAGAAAGAGGATTTCAGTAATTCACAATGGGATTTAACCACTCAGCAGATCCTTCCATACATTGATGGTTTCCGTCACATCCAGAAGATTTCTGCAGAGGCTGATGTGGAACTGAACCTTGTGCGAATTGCAATCCAAACCTGATGTACTATGGAGTGGTTACATTAGTTTCAATATTTCAGTATTCCAATGTATATTGTACAACTCCACTGGGTGCATGAAGCTTATCCATGACAAAGCTTTTACAAGAGGGATTGTCTGGAACTACCCTGAAGTAAGCCAGGCCCTTAAAGCCGGGCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAACCGGAAGATCGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ828980
dbEST ID: 79646682
Trimmed Sequence: CTTCAAACACACAATAATATTGGGATCACTGTCCAGCCTTTCATCAAGCTCCCGATAACTCATCCCTGTTTTGCAGCAGATCTCATCATAGCTGTGGCTCCCCGTATACAGGCGAGCAGGGCTCCTCTCATCACGAGACACCTTCACCGGATATTTGTGCAGCCTCCTGATGAGTTTCTTAATCAGCCCAAACTGAATGAGTTTTCTTTCATCCACTCTTTGTAGCTGCTGTGTATATCGAGCGATCAGATCTCGTACTGTAGTACCTGGGCTTAGGCCACAGTACAGCTGGAAGACATCACGGAGACTGGGCCGCTTAAGGCCTGGCTTACTCACGTAGTTCAGACATTCCTCTTGTAAAGCTTTGTCATGGATAAGCTCATGCACCAGTGGAGTTGTACAATATACATTGGAATACTGAAATATTGAAACTAATGTAACCACTCCATAGTACATCAGGTTTTGGATTGCAATTCGCACAAGGTTCAGTTCCACATCAGCCTCTGCAGAAATCTTCTGGATGTGACGGAAACCATCAATGTATGGAAGGATCTGCTGAGTGGTTAAATCCCATTGTGAATTACTGAAATCCTCTTTCTCTTNCATAAAGACAGGAACATCGTATTCCTGTGCGGTTGGTGGTGACACTCGAGGCTCAATCACTTTCAAATGCATAGTGTTACTCTCATCTATAGGGAGGGAACATTCGCCCCGTGGAAGTTAAGGCCTTTCCAATAAGATTTTCATTAAAAGGGCCCCAATTCCC
Full Trace Sequence: CCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCAAACACACAATAATATTGGGATCACTGTCCAGCCTTTCATCAAGCTCCCGATAACTCATCCCTGTTTTGCAGCAGATCTCATCATAGCTGTGGCTCCCCGTATACAGGCGAGCAGGGCTCCTCTCATCACGAGACACCTTCACCGGATATTTGTGCAGCCTCCTGATGAGTTTCTTAATCAGCCCAAACTGAATGAGTTTTCTTTCATCCACTCTTTGTAGCTGCTGTGTATATCGAGCGATCAGATCTCGTACTGTAGTACCTGGGCTTAGGCCACAGTACAGCTGGAAGACATCACGGAGACTGGGCCGCTTAAGGCCTGGCTTACTCACGTAGTTCAGACATTCCTCTTGTAAAGCTTTGTCATGGATAAGCTCATGCACCAGTGGAGTTGTACAATATACATTGGAATACTGAAATATTGAAACTAATGTAACCACTCCATAGTACATCAGGTTTTGGATTGCAATTCGCACAAGGTTCAGTTCCACATCAGCCTCTGCAGAAATCTTCTGGATGTGACGGAAACCATCAATGTATGGAAGGATCTGCTGAGTGGTTAAATCCCATTGTGAATTACTGAAATCCTCTTTCTCTTNCATAAAGACAGGAACATCGTATTCCTGTGCGGTTGGTGGTGACACTCGAGGCTCAATCACTTTCAAATGCATAGTGTTACTCTCATCTATAGGGAGGGAACATTCGCCCCGTGGAAGTTAAGGCCTTTCCAATAAGATTTTCATTAAAAGGGCCCCAATTCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCAAACACACAATAATATTGGG