ORFeome > nptn ORF1 – XORFeome v1.0

nptn ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nptn
Gene ID: 1011676
Gene Page ID: 1011669
ORF Xenbase ID: 17286795

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126048
Original XGC clone length: 873

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ837782
dbEST ID: 79655484
Trimmed Sequence: ATGGCCCGCTCAGAGCAACCTCCCCTGTCCGCCATCCTCTTCTTGGGGCTGCTCTTGGTTTACTGCGGCCTTTTCCCGGCACCGGCTTATGCCCAGAACGAGCCCAAGATCACTGCCACTGAGGAAATTACCATTAAAAAAGAGACCTCGCCAACACCTATTTTCTTGCAGTGTAACCTCACTACAACTCCTAACCATGTTGAACCAGATAGTGGCTTCTGGACAAAAAATGGCTTGGAGCTTCAAGACACACGCAAGACACCTTCTGACAATATCTTGGAGCTGAAGATTGCAAAGCCAAAGGCAGATGACTCTGGAGAGTATATGTGTGTCTTCATCTTAAAAAATTCCCCACCAGCCAATGCTACTATTGAAGTGAAAGCTGTTCCAGAAATTAGTGGTCATAAAAAAAGTGAAAACAAGAATGAAGGACAAGAGGCTGTGATGTACTGCAAATGTGTTGGATACCCACCACCAGATTGGATGTGGTATAAGATAATTGATGGAGGTCTAATGGAGATTAACAATGCAACTGGACGCTTTTTTATCACAAACAAAGATAACTATACCGAGCTGAAAATCATTAACTTGGATATCAATAATGACCCCGGCACTTACCTTTTGCAATGCCTCCAACACCTGTTGGCTCAGAACACAGCACCACCATTCTTGCGTGTACGCAGTAATTTAGCAACTCCTCTGGCCCCTTCTTGGCCATTGGTTGCAAAAATTGTTATTCC
Full Trace Sequence: TCGAGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCCGCTCAGAGCAACCTCCCCTGTCCGCCATCCTCTTCTTGGGGCTGCTCTTGGTTTACTGCGGCCTTTTCCCGGCACCGGCTTATGCCCAGAACGAGCCCAAGATCACTGCCACTGAGGAAATTACCATTAAAAAAGAGACCTCGCCAACACCTATTTTCTTGCAGTGTAACCTCACTACAACTCCTAACCATGTTGAACCAGATAGTGGCTTCTGGACAAAAAATGGCTTGGAGCTTCAAGACACACGCAAGACACCTTCTGACAATATCTTGGAGCTGAAGATTGCAAAGCCAAAGGCAGATGACTCTGGAGAGTATATGTGTGTCTTCATCTTAAAAAATTCCCCACCAGCCAATGCTACTATTGAAGTGAAAGCTGTTCCAGAAATTAGTGGTCATAAAAAAAGTGAAAACAAGAATGAAGGACAAGAGGCTGTGATGTACTGCAAATGTGTTGGATACCCACCACCAGATTGGATGTGGTATAAGATAATTGATGGAGGTCTAATGGAGATTAACAATGCAACTGGACGCTTTTTTATCACAAACAAAGATAACTATACCGAGCTGAAAATCATTAACTTGGATATCAATAATGACCCCGGCACTTACCTTTTGCAATGCCTCCAACACCTGTTGGCTCAGAACACAGCACCACCATTCTTGCGTGTACGCAGTAATTTAGCAACTCCTCTGGCCCCTTCTTGGCCATTGGTTGCAAAAATTGTTATTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCGCTCAGAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837781
dbEST ID: 79655483
Trimmed Sequence: ATTTGTGTTCCTTTGCCTCAGGTTCTTGTCTTTGTGGTTATTTGTAGAGTTGCTCTTCATTGGTCCAGCTGGTTCATCATCGTCTGGCACCTCGTCCGGCCTCTTGCGCTTTTCATACACCACAATAACAACAGCCAGGATAACAATCTCTGCAACAATGCCCAAGAAGGGCCAGAGAGGTGCTAAATTACTGCGTACACGCAAGATGGTGGTGCTGTTGTCTGAGCCAACAGTGTTGGAGGCATTGCAAAGGTAAGTGCCGGGGTCATTATTGATATCCAAGTTAATGATTTTCAGCTCGGTATAGTTATCTTTGTTTGTGATAAAAAAGCGTCCAGTTGCATTGTTAATCTCCATTAGACCTCCATCAATTATCTTATACCACATCCAATCTGGTGGTGGGTATCCAACACATTTGCAGTACATCACAGCCTCTTGTCCTTCATTCTTGTTTTCACTTTTTTTATGACCACTAATTTCTGGAACAGCTTTCACTTCAATAGTAGCATTGGCTGGTGGGGAATTTTTTAAGATGAAGACACACATATACTCTCCACAGTCATCTGCCTTTGGCTTTGCAATCTTCATCTCCAAGATATTGTCAAAAGGTGTCTTGGGTGTGTCGTTGAAACTCCAAGCCATTTTTTTGTCAGAAGGCCATATCTGGTTCAGCAGGGTTAAGAGTTGTGGTTGAGGTAGAGTGCAGGAGGAAAGTTTTGGGGAAGGCGTCTTTTTCTTATAAATTCGCAATGGCAGTGAGGGGTGGGCGCGTCGTGGCAAACCCGGGTGCGGGGAGAGGGGCGGGAGGGCAAAAACCCCCCGAGACAAGAAGAAGGAAAGGGGGGAGATGGTCTGAACGCCCACGGTGGCGACGTTGTAGTGAAATTTGAAAATAAAAAAAAAAATTGGGCTTGAGTGTGGTGCGCCTAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAATTAATCTCCTCTACATAGAAAGAAACAGAGGTTATCAAACAAAAACACAAACACGGGGGGGGGGGGGGGGGGGGCGCGGGCTGTTTTGTGTTGTTTGTGTTTGGTAGACACCCCCCCAGCCTACACCGAGGCGACGTGGCGCCCGCGGGGGGGGGAGGAGGGATGAAGAGAGGGAA
Full Trace Sequence: TGGCAGGGAACAGCCACTGAACAAGGACAAACGAACCACAAAAGGGGAAGACAGCCAGGAAGGCAATAATGAATATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTTGTGTTCCTTTGCCTCAGGTTCTTGTCTTTGTGGTTATTTGTAGAGTTGCTCTTCATTGGTCCAGCTGGTTCATCATCGTCTGGCACCTCGTCCGGCCTCTTGCGCTTTTCATACACCACAATAACAACAGCCAGGATAACAATCTCTGCAACAATGCCCAAGAAGGGCCAGAGAGGTGCTAAATTACTGCGTACACGCAAGATGGTGGTGCTGTTGTCTGAGCCAACAGTGTTGGAGGCATTGCAAAGGTAAGTGCCGGGGTCATTATTGATATCCAAGTTAATGATTTTCAGCTCGGTATAGTTATCTTTGTTTGTGATAAAAAAGCGTCCAGTTGCATTGTTAATCTCCATTAGACCTCCATCAATTATCTTATACCACATCCAATCTGGTGGTGGGTATCCAACACATTTGCAGTACATCACAGCCTCTTGTCCTTCATTCTTGTTTTCACTTTTTTTATGACCACTAATTTCTGGAACAGCTTTCACTTCAATAGTAGCATTGGCTGGTGGGGAATTTTTTAAGATGAAGACACACATATACTCTCCACAGTCATCTGCCTTTGGCTTTGCAATCTTCATCTCCAAGATATTGTCAAAAGGTGTCTTGGGTGTGTCGTTGAAACTCCAAGCCATTTTTTTGTCAGAAGGCCATATCTGGTTCAGCAGGGTTAAGAGTTGTGGTTGAGGTAGAGTGCAGGAGGAAAGTTTTGGGGAAGGCGTCTTTTTCTTATAAATTCGCAATGGCAGTGAGGGGTGGGCGCGTCGTGGCAAACCCGGGTGCGGGGAGAGGGGCGGGAGGGCAAAAACCCCCCGAGACAAGAAGAAGGAAAGGGGGGAGATGGTCTGAACGCCCACGGTGGCGACGTTGTAGTGAAATTTGAAAATAAAAAAAAAAATTGGGCTTGAGTGTGGTGCGCCTAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAATTAATCTCCTCTACATAGAAAGAAACAGAGGTTATCAAACAAAAACACAAACACGGGGGGGGGGGGGGGGGGGGCGCGGGCTGTTTTGTGTTGTTTGTGTTTGGTAGACACCCCCCCAGCCTACACCGAGGCGACGTGGCGCCCGCGGGGGGGGGAGGAGGGATGAAGAGAGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTGTGTTCCTTTGCCTCAGGT