ORFeome > nr1i2 ORF1 – XORFeome v1.0

nr1i2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nr1i2
Gene ID: 865343
Gene Page ID: 480111
ORF Xenbase ID: 17286825

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC061658
Original XGC clone length: 1167

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11022
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ824770
dbEST ID: 79642472
Trimmed Sequence: ATGTCCGAAGTGCAGGAGGCTGTGGTACTGGAGGAAGAAGAAGAGGAGGAAGAAGACCCCTGTAACAGCTGTGGGACAGGGGAAGACGAGGACGACGGGGAACCTAAAATCTGCCGTGCATGTGGGGACCGAGCTACTGGGTATCACTTCAATGCTATGACATGCGAGGGCTGCAAGGGATTCTTCAGGCGGGCCATGAAGAGGAACTTGCGGCTCAGCTGCCCCTTCCAGAATTCCTGTGTCATCAACAAGAACAATCGGCGGCACTGCCAGGCCTGCCGGCTCAAGAAATGCCTGGACATTGGCATGAGGAAAGAGCTGATCATGTCAGATGAAGCGGTGGAACAGAGGAGAGCGCTAATTAAGAGAAAGCAGAACTTATCCCTGTCGCCCCCCACACCCCCAGGAGCCAGTCTGACTCCAGAGCAGCAGCACTTTATCACTGAACTGGTTGAGGCTCACACCAAAACCTTTGACTTCAACTTCACCTTCTTCAAGAACTTTCGGCCCATAAGGAGATCTCCAGACCCAACTCAGGATCCCCAAGCTACCTCCTCTGAAGCCTTTTTGATGCTACCTCATATATCCGACCTTTTCACCTACATGCTCAAGGGTGTCATCAGCTTTGCCAAAATGCTCCCCTACTTCAGGAGCCCTGGCCATGAAGACCAGATTTGCTCTCTGGAAGGGTCTGGTTCTTGGAAGGTGTGGTGTGATTCGATTTCCACAGGGATGGTCAACCCCAAGAACAATAAACTTGGGGAATTGTGGCGGCCCTCACCCTTTAAAGGGTTAACAAAATTTAAACAATGGGCCGGGCTTTCTCTTTTCAACAATTTCC
Full Trace Sequence: TAATGATTTCATTTTTGACCTGAAAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGAAGTGCAGGAGGCTGTGGTACTGGAGGAAGAAGAAGAGGAGGAAGAAGACCCCTGTAACAGCTGTGGGACAGGGGAAGACGAGGACGACGGGGAACCTAAAATCTGCCGTGCATGTGGGGACCGAGCTACTGGGTATCACTTCAATGCTATGACATGCGAGGGCTGCAAGGGATTCTTCAGGCGGGCCATGAAGAGGAACTTGCGGCTCAGCTGCCCCTTCCAGAATTCCTGTGTCATCAACAAGAACAATCGGCGGCACTGCCAGGCCTGCCGGCTCAAGAAATGCCTGGACATTGGCATGAGGAAAGAGCTGATCATGTCAGATGAAGCGGTGGAACAGAGGAGAGCGCTAATTAAGAGAAAGCAGAACTTATCCCTGTCGCCCCCCACACCCCCAGGAGCCAGTCTGACTCCAGAGCAGCAGCACTTTATCACTGAACTGGTTGAGGCTCACACCAAAACCTTTGACTTCAACTTCACCTTCTTCAAGAACTTTCGGCCCATAAGGAGATCTCCAGACCCAACTCAGGATCCCCAAGCTACCTCCTCTGAAGCCTTTTTGATGCTACCTCATATATCCGACCTTTTCACCTACATGCTCAAGGGTGTCATCAGCTTTGCCAAAATGCTCCCCTACTTCAGGAGCCCTGGCCATGAAGACCAGATTTGCTCTCTGGAAGGGTCTGGTTCTTGGAAGGTGTGGTGTGATTCGATTTCCACAGGGATGGTCAACCCCAAGAACAATAAACTTGGGGAATTGTGGCGGCCCTCACCCTTTAAAGGGTTAACAAAATTTAAACAATGGGCCGGGCTTTCTCTTTTCAACAATTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGAAGTGCAGGAGGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ830133
dbEST ID: 79647835
Trimmed Sequence: CTCATTCAGGGATCCAAAGACCTCTCGCATAAGTGGGGTAACATCTGGCTGTATGTCCCATATCTCCATGAGCTGCTTGCTGTGTATGTCATTAATGGTCCGAAGCTCTGTCAGGCACTCCATGATCTTGGGGTATAGAAGCCTGTTCTGTGGGGAGGGTGGGCGATGGCTCTCGATGAATGCTTTCAGCATCAGGGCAATATGTTCCTGCAGGTTCTGGATCTTCTCACAGTCAGAGACCCCCGGTCGGTCCGAAGAGAAAAGAGCCATGGTAGCCATCAGGGCATATGCCTCACTTTCTAGATTCAGTTTTGTCATCATGCAGTGTATTCTCAGCAGGGGCTCAAGGAACTGTTGACTGAAGCCGGCCATGGTCATATCGTCAGCATTATAGGTGAAGGCGCCACACTCCCACGTATTGGTCTTGGGGTTGAACATCCTGTTGAATCGAATCACACACACCTCCAGGACAGAACCCTTCAGGAGAGCAATCTGGTCTTCAATGGCCAGGCTCCTGAAGTAGGGGAGCATTTTGGCAAAGCTGATGACACCCTTGAGCATGTAGGTGAAAAGGTCGGATATATGAGGTAGCATCAAAAAGGCTTCAGAGGAGGTAGCTTGGGGGATCCTNGAGTGGGGTCTGGAGATCTCCTAATGGGGCCGAAAGTTCCTGAAAGAAAGGTGAGGTTTGAACTCAAAAGGGTTTTGGGTGTGGAGCCCCCACCCAGTTTCAAGTTGATAAAGGTGCTGTCTTCCTTCTGGAATCAAA
Full Trace Sequence: CCGTGTAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCATTCAGGGATCCAAAGACCTCTCGCATAAGTGGGGTAACATCTGGCTGTATGTCCCATATCTCCATGAGCTGCTTGCTGTGTATGTCATTAATGGTCCGAAGCTCTGTCAGGCACTCCATGATCTTGGGGTATAGAAGCCTGTTCTGTGGGGAGGGTGGGCGATGGCTCTCGATGAATGCTTTCAGCATCAGGGCAATATGTTCCTGCAGGTTCTGGATCTTCTCACAGTCAGAGACCCCCGGTCGGTCCGAAGAGAAAAGAGCCATGGTAGCCATCAGGGCATATGCCTCACTTTCTAGATTCAGTTTTGTCATCATGCAGTGTATTCTCAGCAGGGGCTCAAGGAACTGTTGACTGAAGCCGGCCATGGTCATATCGTCAGCATTATAGGTGAAGGCGCCACACTCCCACGTATTGGTCTTGGGGTTGAACATCCTGTTGAATCGAATCACACACACCTCCAGGACAGAACCCTTCAGGAGAGCAATCTGGTCTTCAATGGCCAGGCTCCTGAAGTAGGGGAGCATTTTGGCAAAGCTGATGACACCCTTGAGCATGTAGGTGAAAAGGTCGGATATATGAGGTAGCATCAAAAAGGCTTCAGAGGAGGTAGCTTGGGGGATCCTNGAGTGGGGTCTGGAGATCTCCTAATGGGGCCGAAAGTTCCTGAAAGAAAGGTGAGGTTTGAACTCAAAAGGGTTTTGGGTGTGGAGCCCCCACCCAGTTTCAAGTTGATAAAGGTGCTGTCTTCCTTCTGGAATCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCATTCAGGGATCCAAAGAC