ORFeome > nras ORF1 – XORFeome v1.0

nras ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nras
Gene ID: 6085929
Gene Page ID: 6085897
ORF Xenbase ID: 17286879

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133746
Original XGC clone length: 570

Human orthology & disease relationships

NCBI Entrez ID: 4893
Ensembl gene IDs: ENSG00000213281,LRG_92
Directly associated (OMIM) disease MIM numbers: 114500,137550,162900,188470,249400,613224,614470
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ838499
dbEST ID: 79656201
Trimmed Sequence: ATGACAGAATATAAACTGGTGGTGGTGGGAGCAGGAGGTGTTGGGAAAAGTGCCTTAACAATCCAGCTTATACAGAACCATTTTGTAGATGAGTATGATCCTACTATCGAGGATTCCTATAGAAAACAGGTAGTGATTGATGGAGAGACTTGCCTGTTGGATATTTTAGACACGGCTGGTCAAGAGGAATACAGTGCTATGCGTGACCAGTATATGAGGACCGGGGAAGGATTTCTGTGTGTATTTGCTATTAATAACAGCAAGTCTTTTGCTGATATTAATGCCTACAGGGAACAGATAAAACCAGTGAAAGACTCAGATGATGTCCCCATGGTGCTTGTTGGAAATAAATGCGATTTGCCAAGCAGAACCGTGGATACCAAGCAAGCCCAAGAGCTTGCCAGAAGCTATGGAATTCCTTTCATCGAGACCTCCGACAAGACAAGACAAGAGATAGAAGATGCATTTTACACCTTGTTTTAAAGAAATTCATCCATTATAAAATGAATAAAATTAAACACACATGAAGATAACAATCAAGGATGTAATCCAATTCCCTGCTACCCTTATTATACAACTTTCTAGTACCAAAGATAGCAATTAAAAAAAAACCTATGAATATCAAGTTTGTTGGAACCAAAAAAGAAAAATATAAANTAAAAATTAAAATCTATTATTTGACCAACCAGGTTAATATACCCGCAGAGTCAGGTCCAAAAAAAAAAAAAACAAAAAAAAATATAAAAACAAAGACGCAAGACCCCACCCTAAAAAAAAAAAAACTAAGATTTCAAATAAACACAAAGTTCTTATGTGTTATTTATCCCCGGTT
Full Trace Sequence: GCTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAGAATATAAACTGGTGGTGGTGGGAGCAGGAGGTGTTGGGAAAAGTGCCTTAACAATCCAGCTTATACAGAACCATTTTGTAGATGAGTATGATCCTACTATCGAGGATTCCTATAGAAAACAGGTAGTGATTGATGGAGAGACTTGCCTGTTGGATATTTTAGACACGGCTGGTCAAGAGGAATACAGTGCTATGCGTGACCAGTATATGAGGACCGGGGAAGGATTTCTGTGTGTATTTGCTATTAATAACAGCAAGTCTTTTGCTGATATTAATGCCTACAGGGAACAGATAAAACCAGTGAAAGACTCAGATGATGTCCCCATGGTGCTTGTTGGAAATAAATGCGATTTGCCAAGCAGAACCGTGGATACCAAGCAAGCCCAAGAGCTTGCCAGAAGCTATGGAATTCCTTTCATCGAGACCTCCGACAAGACAAGACAAGAGATAGAAGATGCATTTTACACCTTGTTTTAAAGAAATTCATCCATTATAAAATGAATAAAATTAAACACACATGAAGATAACAATCAAGGATGTAATCCAATTCCCTGCTACCCTTATTATACAACTTTCTAGTACCAAAGATAGCAATTAAAAAAAAACCTATGAATATCAAGTTTGTTGGAACCAAAAAAGAAAAATATAAANTAAAAATTAAAATCTATTATTTGACCAACCAGGTTAATATACCCGCAGAGTCAGGTCCAAAAAAAAAAAAAACAAAAAAAAATATAAAAACAAAGACGCAAGACCCCACCCTAAAAAAAAAAAAACTAAGATTTCAAATAAACACAAAGTTCTTATGTGTTATTTATCCCCGGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAGAATATAAACTGGTGGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838498
dbEST ID: 79656200
Trimmed Sequence: CATAAGCTTGCAGGGAATTCGGATACATCCTTGATTGTTATCTTCACTGCTGTCCAATTTCTTCATTCTATACTGATGAATTTCTCTAACCAAGGTGTAAAATGCATCTTCTACCCCCTGTCTTGTCTTTGCCGAGGTCTCGATGAAAGGAATTCCATAGCTTCTGGCAAGCTCTTGGGCTTGCTTGGTATCCACGGTTCTGCTTGGCAAATCGCATTTATTTCCAACAAGCACCATGGGGACATCATCTGAGTCTTTCACTCGTTTTATCTGTTCCCTGTAGGCATTAATATCAGCAAAAGACTTGCTGTTATTAATAGCAAATACACACAGAAATCCTTCCCCGGTCCTCATATACTGGTCACGCATAGCACTGTATTCCTCTTGACCAGCCGTGTCTAAAATATCCNACAGGCAAGTCTCTCCATCAATCACTACCTGTTTTCTATAGGAATCCTCGATAGTAGGATCATACTCATCTACAAGATGGTTCTGTATAAGCTGGATTGTTAAGGCACTTTTCCCAACACCTCCTGCTCCCCGCACCACCAGTTTATATTCTGTCATGGTGGCAGCTTTTTTGTACAAATTTGGCATTAAAAAAAACAATTGCTAACAATTTGTTGCCAACAAAAGGTTACTATCAATAAAAAAAAAAAAAATAAATTGGAGCCGTAGCTTAAAACTTGCCGTGGGTTTCAGAAAAATTTTTAAACTGGGGGGNGANNGGGGNTTCNTGTTTAACCCAACGGGGGGAAGAGGAA
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATAAGCTTGCAGGGAATTCGGATACATCCTTGATTGTTATCTTCACTGCTGTCCAATTTCTTCATTCTATACTGATGAATTTCTCTAACCAAGGTGTAAAATGCATCTTCTACCCCCTGTCTTGTCTTTGCCGAGGTCTCGATGAAAGGAATTCCATAGCTTCTGGCAAGCTCTTGGGCTTGCTTGGTATCCACGGTTCTGCTTGGCAAATCGCATTTATTTCCAACAAGCACCATGGGGACATCATCTGAGTCTTTCACTCGTTTTATCTGTTCCCTGTAGGCATTAATATCAGCAAAAGACTTGCTGTTATTAATAGCAAATACACACAGAAATCCTTCCCCGGTCCTCATATACTGGTCACGCATAGCACTGTATTCCTCTTGACCAGCCGTGTCTAAAATATCCNACAGGCAAGTCTCTCCATCAATCACTACCTGTTTTCTATAGGAATCCTCGATAGTAGGATCATACTCATCTACAAGATGGTTCTGTATAAGCTGGATTGTTAAGGCACTTTTCCCAACACCTCCTGCTCCCCGCACCACCAGTTTATATTCTGTCATGGTGGCAGCTTTTTTGTACAAATTTGGCATTAAAAAAAACAATTGCTAACAATTTGTTGCCAACAAAAGGTTACTATCAATAAAAAAAAAAAAAATAAATTGGAGCCGTAGCTTAAAACTTGCCGTGGGTTTCAGAAAAATTTTTAAACTGGGGGGNGANNGGGGNTTCNTGTTTAACCCAACGGGGGGAAGAGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATAAGCTTGCAGGGAATTCGG