ORFeome > nrsn1 ORF2 – XORFeome v1.0

nrsn1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nrsn1
Gene ID: 1005886
Gene Page ID: 1005880
ORF Xenbase ID: 17286951

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106630
Original XGC clone length: 588

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ837664
dbEST ID: 79655366
Trimmed Sequence: ATGAGTTCATGTGCTGACATCTGTGGGTCCAAACAACCTCAAAATACTCCAGAAGGAATATACCATCGTTATGGAGTTCGGTCCTACCTCCACCAGTTTTATGAGGACTGCACAGCTTCAATCTGGGAATATGATGATGATTTTCAGATCCAGAGATCGCCTAGTAGGTGGAGCTCTGCTTTCTGGAAGGTCGGACTCATATTGGGCATTATCCTCATGCTGGCGGGTCTAACGGTGCTTTCAGTGGGGTTTCTAGTACCACCTAAAATCGAAGCTTTTGGGGAAGATGATTTTGTGGTCGTGGATAGCCACGCCATTCAGTTCAACGGAGCCCTTGATATCTGTAAGTTATCAGGGGCCATTTTGTTCTGCATTGGAGGAACTACACTGGCTGCATGTCTTTTGATGTCTGCCTTTGCTAAAAGTTACTCCAAAGAAGAAAAGTACCTTCAACAAAAATTTAAAGAAAGAATAGCAGACCTAAAAGCTCACGTTCATCCNGTGACAAAGGCCCCAGCTCCAGGAGAAGCAAAGATACCCGTCACTTTGTCCAAAGTTCAAAATGTCCAGCCTTCATCAGAAACCTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTTCATGTGCTGACATCTGTGGGTCCAAACAACCTCAAAATACTCCAGAAGGAATATACCATCGTTATGGAGTTCGGTCCTACCTCCACCAGTTTTATGAGGACTGCACAGCTTCAATCTGGGAATATGATGATGATTTTCAGATCCAGAGATCGCCTAGTAGGTGGAGCTCTGCTTTCTGGAAGGTCGGACTCATATTGGGCATTATCCTCATGCTGGCGGGTCTAACGGTGCTTTCAGTGGGGTTTCTAGTACCACCTAAAATCGAAGCTTTTGGGGAAGATGATTTTGTGGTCGTGGATAGCCACGCCATTCAGTTCAACGGAGCCCTTGATATCTGTAAGTTATCAGGGGCCATTTTGTTCTGCATTGGAGGAACTACACTGGCTGCATGTCTTTTGATGTCTGCCTTTGCTAAAAGTTACTCCAAAGAAGAAAAGTACCTTCAACAAAAATTTAAAGAAAGAATAGCAGACCTAAAAGCTCACGTTCATCCNGTGACAAAGGCCCCAGCTCCAGGAGAAGCAAAGATACCCGTCACTTTGTCCAAAGTTCAAAATGTCCAGCCTTCATCAGAAACCTTGCCAACTTTCTTGTACAAGGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCACCGAACAGGTCACTATCAATCAAAATAAAATCAATATTTGGCATCCAACTTAAAACCCCCTATAGTGAGTCCTTAATTACATGGGGCAAAAAAAAAATAAGGGGAAACATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTCATGTGCTGACATC

Sequences - 3ʹ (reverse) EST

Accession: JZ837663
dbEST ID: 79655365
Trimmed Sequence: GGTTTCTGATGAAGGCTGGACATTTTGAACTTTGGACAAAGTGACGGGTATCTTTGCTTCTCCTGGAGCTGGGGCCTTTGTCACTGGATGAACGTGAGCTTTTAGGTCTGCTATTCTTTCTTTAAATTTTTGTTGAAGGTACTTTTCTTCTTTGGAGTAACTTTTAGCAAAGGCAGACATCAAAAGACATGCAGCCAGTGTAGTTCCTCCAATGCAGAACAAAATGGCCCCTGATAACTTACAGATATCAAGGGCTCCGTTGAACTGAATGGCGTGGCTATCCACGACCACAAAATCATCTTCCCCAAAAGCTTCGATTTTAGGTGGTACTAGAAACCCCACTGAAAGCACCGTTAGACCCGCCAGCATGAGGATAATGCCCAATATGAGTCCGACCTTCCAGAAAGCAGAGCTCCACCTACTAGGCGATCTCTGGATCTGAAAATCATCATCATATTCCCAGATTGAAGCTGTGCAGTCCTCATAAAACTGGTGGAGGTAGGACCGAACTCCATAACGATGGTATATTCCTTCTGGAGTATTTTGAGGTTGTTTGGACCCACAGATGTCAGCACATGAACTCATGG
Full Trace Sequence: GGCAGGGTAACAGCCACTGAACCATGTAAAACGAACCACTATACGGGGAAGAAAGCCAGGAGGGCAAAAACGAGTATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGTTTCTGATGAAGGCTGGACATTTTGAACTTTGGACAAAGTGACGGGTATCTTTGCTTCTCCTGGAGCTGGGGCCTTTGTCACTGGATGAACGTGAGCTTTTAGGTCTGCTATTCTTTCTTTAAATTTTTGTTGAAGGTACTTTTCTTCTTTGGAGTAACTTTTAGCAAAGGCAGACATCAAAAGACATGCAGCCAGTGTAGTTCCTCCAATGCAGAACAAAATGGCCCCTGATAACTTACAGATATCAAGGGCTCCGTTGAACTGAATGGCGTGGCTATCCACGACCACAAAATCATCTTCCCCAAAAGCTTCGATTTTAGGTGGTACTAGAAACCCCACTGAAAGCACCGTTAGACCCGCCAGCATGAGGATAATGCCCAATATGAGTCCGACCTTCCAGAAAGCAGAGCTCCACCTACTAGGCGATCTCTGGATCTGAAAATCATCATCATATTCCCAGATTGAAGCTGTGCAGTCCTCATAAAACTGGTGGAGGTAGGACCGAACTCCATAACGATGGTATATTCCTTCTGGAGTATTTTGAGGTTGTTTGGACCCACAGATGTCAGCACATGAACTCATGGTGCCGACTTTTTTGTACAAAATTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGCAACGAACAGGTCACTAGCAGTCAAAATAGAATCATTATTTTGGGAAAAAAAAAAAAAACAGAACATCATTTTACGACAAAATTGACCTGGGCGCGGGAAAAAAATAGCGCCGCTCCCGCCCCACACGGGGGTCTCGGGTAACACGGGGGGGGAGGGGGAAAAGCCCCACGCCCGGGAAATACGCGGGGTTGGTGTTGAAAAAAAAGAAAAAACAAAAGAGACAAAAAAAAGGGGCCAGAAGCTAGAAAAGGCCGGGGGGGAAAAAAACAGAAGANGGTTTGGGTGGGGGGGAGGGGGTGTTTTTGGTTTTTTGTTATGTGGGAGGGGGGGGGACGAGGAAGCCGTGGCGGGGGGGGGAGAAGANAGGGCGGCGGAGGAGAAAGGGAAGAGGTAAAGGAGAGGAGGAGCGGGGGAGCGGAGGGGGGAGGGGGGAGAGNNGAAGAGGAGGAGNGCGAGAGATNAGAGGGGGAGCAGGGGNGGGCAGGGGGGGCGGGCAGGGGGGAGAAAGAACACGGGAAGAGGANGAAAAGGNAGAAGAGGAAGGNAGGGGAGAAGAGAGGAAGAAAGGAAGCNNCNNGAAGGNCAGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTTTCTGATGAAGGCTG