ORFeome > nsmce2 ORF1 – XORFeome v1.0

nsmce2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nsmce2
Gene ID: 6256344
Gene Page ID: 6457748
ORF Xenbase ID: 17286981

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044994
Original XGC clone length: 717

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ823980
dbEST ID: 79641682
Trimmed Sequence: ATGTCTGGCCGGTCAGCGCCTGTGGTTTCCTTCAGCTCTGTGGATAACTCCCTGTCATCTCTAAAAAACTGCCAGGGCTACCTACACACGGGAATGGATATCACGGTCAGTGTGGCCCTCGACCTGCTCGAGACTGGATGTGAATCCACTGAGGTAGATGCAATGGAATCAGTGATGCTGGAATATTCAGCAATGGAGAGAGATTTAAAGCAATACATACACGCAGTGGAGGAGACTGTGCAGAAGTTAAGACGAGAACAGATGGAACAAGTCCCCGATCTCCAGTCTCTGGTACAAGAGAAATATGCAACGATACAGAAAAAAAACGACGACAAAAACTTGAAGAAAAACGACCGATTTGTTCAATTTAAAGATCAGCTTAAAGAAATGAGAAAGCAAATGGGAGAAAAAGAGGAGGGAGACGCGGCCTTTGAGAATGTTGATGAAGATATCGCAGTGCTGCCGAGCCAGCAAAACTTAACATGCCCAATTACACAGATGGAGATGACAAACCCAGTGAAAAACAAAGTATGCGGTCACACCTATGAGAAGGAGGCCATAGAAAGGATGATTCAAGACAGGCACCAGAAGAAGAAGAGGGTTAAGTGTCCCAAAGTTGGCTGCGTTCACTCCGACATGCAAATATCGGATCTTGTTCCAGACACCGCGCTGAANAGGACCATTGACATTCTGAACAAGCAGAAAGGCCGTCATTT
Full Trace Sequence: AATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGGCCGGTCAGCGCCTGTGGTTTCCTTCAGCTCTGTGGATAACTCCCTGTCATCTCTAAAAAACTGCCAGGGCTACCTACACACGGGAATGGATATCACGGTCAGTGTGGCCCTCGACCTGCTCGAGACTGGATGTGAATCCACTGAGGTAGATGCAATGGAATCAGTGATGCTGGAATATTCAGCAATGGAGAGAGATTTAAAGCAATACATACACGCAGTGGAGGAGACTGTGCAGAAGTTAAGACGAGAACAGATGGAACAAGTCCCCGATCTCCAGTCTCTGGTACAAGAGAAATATGCAACGATACAGAAAAAAAACGACGACAAAAACTTGAAGAAAAACGACCGATTTGTTCAATTTAAAGATCAGCTTAAAGAAATGAGAAAGCAAATGGGAGAAAAAGAGGAGGGAGACGCGGCCTTTGAGAATGTTGATGAAGATATCGCAGTGCTGCCGAGCCAGCAAAACTTAACATGCCCAATTACACAGATGGAGATGACAAACCCAGTGAAAAACAAAGTATGCGGTCACACCTATGAGAAGGAGGCCATAGAAAGGATGATTCAAGACAGGCACCAGAAGAAGAAGAGGGTTAAGTGTCCCAAAGTTGGCTGCGTTCACTCCGACATGCAAATATCGGATCTTGTTCCAGACACCGCGCTGAANAGGACCATTGACATTCTGAACAAGCAGAAAGGCCGTCATTTGCCCACTTTCTTGTACAAAGTTGGCAATAATAGAAAAGCATTGCCTTAATCATTTGGTTGCAAACGAAAAGGTCCCTATCAATTCAAAAAAAAAATCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGGCCGGTCAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ829289
dbEST ID: 79646991
Trimmed Sequence: ATGACGGCCTTTCTGCTTGTTCAGAATGTCAATGGTCCTTTTCAGCGCGGTGTCTGGAACAAGATCCGATATTTGCATGTCGGAGTGAACGCAGCCAACTTTGGGACACTTAACCCTCTTCTTCTTCTGGTGCCTGTCTTGAATCATCCTTTCTATGGCCTCCTTCTCATAGGTGTGACCGCATACTTTGTTTTTCACTGGGTTTGTCATCTCCATCTGTGTAATTGGGCATGTTAAGTTCTGCTGGCTCGGCAGCACTGCGATATCTTCATCAACATTCTCAAAGGCCGCGTCTCCCTCCTCTTTTTCTCCCATTTGCTTTCTCATTTCTCTAAGCTGATCTTTAAATTGAACAAATCGGTCGTTTTTCTTCAAGTCTTCGTCGTCGTTTTTTTTCTGTATCGTTGCATATTTCTCTTGTACCAGAGACTGGAGATCGGGGACTTGTTCCATCTGTTCTCGTCTTAACTTCTGCACAGTCTCCTCCACTGCGTGTATGTATTGCTTTAAATCTCTCTCCATTGCTGAATATTCCAGCATCACTGATTCCATTGCATCTACCTCAGTGGATTCCCATCCAGTCTCGAGCAAGTCGAGGGCCACACTGACCGTGATATTCATTTCCGTGTGGAGGTAGCCCTGGCAGTTTTTTTAAAGATGACAGGGAGTTAAACCCCAGAACCTAAGAGAACCCACAGGCCCTGAACGGCCCAAACATGGGGCCCAACTTTTTTTGTAAAAAGTTTGGGATTTAAAAAAAAAGCCATTTGC
Full Trace Sequence: GGGAGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGACGGCCTTTCTGCTTGTTCAGAATGTCAATGGTCCTTTTCAGCGCGGTGTCTGGAACAAGATCCGATATTTGCATGTCGGAGTGAACGCAGCCAACTTTGGGACACTTAACCCTCTTCTTCTTCTGGTGCCTGTCTTGAATCATCCTTTCTATGGCCTCCTTCTCATAGGTGTGACCGCATACTTTGTTTTTCACTGGGTTTGTCATCTCCATCTGTGTAATTGGGCATGTTAAGTTCTGCTGGCTCGGCAGCACTGCGATATCTTCATCAACATTCTCAAAGGCCGCGTCTCCCTCCTCTTTTTCTCCCATTTGCTTTCTCATTTCTCTAAGCTGATCTTTAAATTGAACAAATCGGTCGTTTTTCTTCAAGTCTTCGTCGTCGTTTTTTTTCTGTATCGTTGCATATTTCTCTTGTACCAGAGACTGGAGATCGGGGACTTGTTCCATCTGTTCTCGTCTTAACTTCTGCACAGTCTCCTCCACTGCGTGTATGTATTGCTTTAAATCTCTCTCCATTGCTGAATATTCCAGCATCACTGATTCCATTGCATCTACCTCAGTGGATTCCCATCCAGTCTCGAGCAAGTCGAGGGCCACACTGACCGTGATATTCATTTCCGTGTGGAGGTAGCCCTGGCAGTTTTTTTAAAGATGACAGGGAGTTAAACCCCAGAACCTAAGAGAACCCACAGGCCCTGAACGGCCCAAACATGGGGCCCAACTTTTTTTGTAAAAAGTTTGGGATTTAAAAAAAAAGCCATTTGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGACGGCCTTTCTGCTT