ORFeome > nsun6 ORF1 – XORFeome v1.0

nsun6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nsun6
Gene ID: 947962
Gene Page ID: 947956
ORF Xenbase ID: 17286999

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123125
Original XGC clone length: 1404

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCTTTTTCCCTAAGATTCTATTGAAGAGTGAATTGAATAGCTATCTGCGTAAAGTGTTTACTAATGAAGAACTAGTGGCATCCGTACGTGGTCACGAAGCAGATTACATCGTTGAAATGATATGGAATCAACTGACCCACCTCCCAACGTTCATCAGTGGACGATTTTTAATTGCTCGATTGACAACTTTCTTGTAGTACGTTGGCATTATAATAAAGCAATGCTTATCACTTTGTTGCGACGAACAGGTCACAATCAGTCAAAATAAAATCAATAATTGCCATGCGCGAGACACCTTTTAGAGTGAGTCATAATACATGTCCATATATGTTTACTGGCAACTGCTGGACCCTCAAAAAAATCCCGTGATGTTAACAATTTCACAAAACTTATACTTTTCTCTTACGAGTCGTTCGGCTTCCTCTGGATTTTCNGCCTCTATACTTACTAAACGTGATAAAGTTTCTGTAATTTCTACTGTATTGACCTGCAGACTGCCTGTGTATAAGGAAGACTGAAATTTTTATTCCCCATAACATCAGGTTTAATGGCGGTCTTGATTGTCATTTTACCTGGGCCAGAAAACGAAAATAAATAAGTATTAAAAAAGAATATCTATTGATGAATTACTATAGTATTTTTGTTCCTAGCTATATTCCAAAGAATAACAATTTTGACATAAACATCTATAAAATCATGTNAAAGAAACAAGAAAAAGACCATCACGAAGAAAAAAAAAAAAATAAATAAACATAACTCTAAATGCCAATACTTACACTATATCTCTAAACCAGATATAAAAAGTGTATGGTGATTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCTTTTTCCCTAAGATTCTA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GAAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTTGCCTTTAAAAATCGAGCAATAGTAAAAGATGGAGGATGGGCCCGGTGCTTCAGAAGGTTTTCTGAGAGGCTTTCAGCTTCAGGACCACCCTATGATGCCACTACTTATATGGTATTAGGGACTTGACGACAAGGCTTTCGCCTTCACTCATCAATACAATCTGCGCCAAAAAGGAGCTGGTGACAACTTTTTTGTAAAAAGATGGCAATATACGAGAAGAGTGCGAAACAATTTGGTGCAGCGAAGAGGTGAGTATCAGTCCGAATAAATTCATTATTTGGGGCCGAAGCGGGAGACGCTCGGTGGGGGAAAAAAANTCGTGTCGTGGTNNTCGGGAAGAAGANNNNNNNNNNNTCTCGTNNNNNNNNCNTNTNNNNNNNNNATANNNNTNCGNNNNNNNNNNNNNNNNNCCNTNNGNGNCGNNNNGGNGNNNNNNNCCCNGGNNNTNNNNNNNNNNNGGNGNNNNNNTNNGNNGGGGGGNGNNNNNNNNNNNGGNNGNNNNNNNNNNNGNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNGNNNNNNNNNGNNGNNNNNNNNNNNNNNGNNNNGNNGGNNNNNNNNNNNNNNNNNNNNGGAAAAAAAAGAAGNNAANANGNNNNNNNNNNNGNNNANNGANAAAANAAGGAAAGAAAAAAAAAAAAAAGNAANNNCANTNGNNNNGNNGNNGNNNTGNNTGTGNNNNNGGGAAAAGGNGGGGNGNGGGAGNNNNNNAGGNGGNANNNNNGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTTGCCTTTAAAAATCGAGCAAT