ORFeome > nthl1 ORF1 – XORFeome v1.0

nthl1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nthl1
Gene ID: 962533
Gene Page ID: 962529
ORF Xenbase ID: 17287065

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054164
Original XGC clone length: 1272

Human orthology & disease relationships

NCBI Entrez ID: 4913
Ensembl gene IDs: ENSG00000065057
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 133239,151623,211980,260500,275355

Library Location

Plate ID: GDExl11001
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ839172
dbEST ID: 79656874
Trimmed Sequence: ATGGCGTCTATATGGGAAGAAACGGAGGCAGATGGGTTGGGAGAAGAGGTCCTCAAAATGTCCACGGAAGAGATAATCCAGAGAACTCGGCTGCTGGACAGTGAAATCAAAATCATGAAAAGTGAGGTTTTGAGAGTCACCCACGAGCTGCAAGCAATGAGAGACAAAATAAAAGAAAACAGTGAGAAAATCAAAGTGAATAAAACCCTCCCATACCTGGTGTCCAATGTCATAGAGCTCCTGGATGTCGATCCTAACGATCAGGAAGAGGATGGAGCTAACATTGATTTAGACTCTCAGAGAAAGGGAAAGTGTGCTGTGATTAAAACCTCAACTCGACAGACCTACTTCTTGCCAGTCATTGGTTTGGTCGATGCAGAGAAACTGAAGCCTGGAGATCTTGTGGGAGTGAACAAAGATTCTTACCTTATTTTGGAGACTCTTCCTACGGAATATGATTCTCGTGTGAAGGCCATGGAAGTGGACGAGAGGCCCACCGAGCAATACAGTGACATAGGAGGTCTGGATAAACAGATCCAGGAGCTTGTTGAGGCCATTGTACTGCCCATGAACCACAAGGAAAAGTTTGAGAATTTAGGAATTCAGCCCCCTAAGGGTGTTCTTATGTACGGCCCCCCTGGCACTGGGAAAAACCTGCTGGCTAGAGCATGGGCCGCTCAGACTAAAGCTCCCTTTTCTAAACTTGGCCGCCCACCGCCTGTGGAAAATGTG
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGTCTATATGGGAAGAAACGGAGGCAGATGGGTTGGGAGAAGAGGTCCTCAAAATGTCCACGGAAGAGATAATCCAGAGAACTCGGCTGCTGGACAGTGAAATCAAAATCATGAAAAGTGAGGTTTTGAGAGTCACCCACGAGCTGCAAGCAATGAGAGACAAAATAAAAGAAAACAGTGAGAAAATCAAAGTGAATAAAACCCTCCCATACCTGGTGTCCAATGTCATAGAGCTCCTGGATGTCGATCCTAACGATCAGGAAGAGGATGGAGCTAACATTGATTTAGACTCTCAGAGAAAGGGAAAGTGTGCTGTGATTAAAACCTCAACTCGACAGACCTACTTCTTGCCAGTCATTGGTTTGGTCGATGCAGAGAAACTGAAGCCTGGAGATCTTGTGGGAGTGAACAAAGATTCTTACCTTATTTTGGAGACTCTTCCTACGGAATATGATTCTCGTGTGAAGGCCATGGAAGTGGACGAGAGGCCCACCGAGCAATACAGTGACATAGGAGGTCTGGATAAACAGATCCAGGAGCTTGTTGAGGCCATTGTACTGCCCATGAACCACAAGGAAAAGTTTGAGAATTTAGGAATTCAGCCCCCTAAGGGTGTTCTTATGTACGGCCCCCCTGGCACTGGGAAAAACCTGCTGGCTAGAGCATGGGCCGCTCAGACTAAAGCTCCCTTTTCTAAACTTGGCCGCCCACCGCCTGTGGAAAATGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTCTATATGGGAAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839171
dbEST ID: 79656873
Trimmed Sequence: TGCATAGTACTGTAAATTGGCTTTTTTCTTGGCCTGGACTTCTAAGATGCCCTCCATATAATCCTCGTGTGTTAATTCAGTGGCTCCTCTGCGCAGAGCAATCATTCCGGCTTCCACACAAACTGCTTTGCACTGAGCGCCATTGAAATCGTCGGTACAGCGAGCCAGCTCCTCATAATTCACATCAGGGCTGACATTCATCTTACGGGAATGGATCTGCATGATACGTGCTCTGGCCTCTTCATTGGGCATGGGGAACTCAATCTTCCGATCTAGACGCCCAGAACGCAGCAGTGCCGGATCCAGGATATCCACACGATTAGTAGCGGCAATCACCTTGACTTGCATGTTTGGCTGAAACCCATCCAGCTGATTAAGAAGCTCAAGCATTGTTCTCTGCACCTCCCTGTCTCCTGCTTTCTCACTGTCAAATCTTTTTGTGCCAATAGCATCAAGTTCATCAATGAAAATGATAGAAGGTGCTTTCTCCTTGGCCAGAGCGAAAGCATCTCGCACCAGTTTGGCACCGTCTCCAATAAACATCTGCACTAGCTGTGGGCCGGCAAGCTTCAGAAAGGTAGCCTTAGTCTGAGCTGCACATGCTCTAGCCAGCAGGGTCTTCCCAGTTCCAGGGGGGGGGTACATAAGAACACCTTTAGGGGGCTGAATTTCTAAATTCTCAAACTTTTCCTTGGTGGTTCAGGGGCCGTAAAAATGGCCCTTCACA
Full Trace Sequence: GCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCATAGTACTGTAAATTGGCTTTTTTCTTGGCCTGGACTTCTAAGATGCCCTCCATATAATCCTCGTGTGTTAATTCAGTGGCTCCTCTGCGCAGAGCAATCATTCCGGCTTCCACACAAACTGCTTTGCACTGAGCGCCATTGAAATCGTCGGTACAGCGAGCCAGCTCCTCATAATTCACATCAGGGCTGACATTCATCTTACGGGAATGGATCTGCATGATACGTGCTCTGGCCTCTTCATTGGGCATGGGGAACTCAATCTTCCGATCTAGACGCCCAGAACGCAGCAGTGCCGGATCCAGGATATCCACACGATTAGTAGCGGCAATCACCTTGACTTGCATGTTTGGCTGAAACCCATCCAGCTGATTAAGAAGCTCAAGCATTGTTCTCTGCACCTCCCTGTCTCCTGCTTTCTCACTGTCAAATCTTTTTGTGCCAATAGCATCAAGTTCATCAATGAAAATGATAGAAGGTGCTTTCTCCTTGGCCAGAGCGAAAGCATCTCGCACCAGTTTGGCACCGTCTCCAATAAACATCTGCACTAGCTGTGGGCCGGCAAGCTTCAGAAAGGTAGCCTTAGTCTGAGCTGCACATGCTCTAGCCAGCAGGGTCTTCCCAGTTCCAGGGGGGGGGTACATAAGAACACCTTTAGGGGGCTGAATTTCTAAATTCTCAAACTTTTCCTTGGTGGTTCAGGGGCCGTAAAAATGGCCCTTCACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCATAGTACTGTAAATTGGCTTT