ORFeome > ntrk2 ORF1 – XORFeome v1.0

ntrk2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ntrk2
Gene ID: 6256346
Gene Page ID: 922931
ORF Xenbase ID: 17287089

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044959
Original XGC clone length: 1431

Human orthology & disease relationships

NCBI Entrez ID: 4915
Ensembl gene IDs: ENSG00000148053
Directly associated (OMIM) disease MIM numbers: 613886
Indirectly associated (Lage, et al.) disease MIM numbers: 121900,122200,188550,209880,256800,308240,607541,608470,608471

Library Location

Plate ID: GDExl11010
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ823812
dbEST ID: 79641514
Trimmed Sequence: ATGCGCCTCTGGAAAGGTTCCCACGGACCTGATTTAGTTGAGGTGTATGGCGCTCTATGGATCCTACTTGCCTTGTTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCACTTTAATGGACAAGGGGATTCCGGCTTTCCCGGTGCTGGAGGACAGCTCACTGGCAGAGAACATCACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGATGATGTTAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCCGCAAGAACCTTAAACTTACATACATAAATTTCTCCAGAAATAAGCTAACATCTTTAACCAAGAAGATTTTTCGCCATCTGACCTTATCTCAGCTGCTTCTTGGTGGCAATCCTTTCCAGTGCTCGTGTGATTTAATGTGGGTTAAAGTATTACTGGAGACTAATTCCCTGAACATGGAGAACCAAAATATACACTGCTTCAATGACAACAAAAAGAAGATTCCTCTCTTCAATATGCACATACCCAACTGTGGGTTGCCTATAGCAAATGTGAGTACGATAAATATCACAGTTCTTGAAGGTAATGAGACAACCCTGTACTGTGATGCCAACGGACTCCCAGACCCAAATGTCTCCTGGGATATCTCACAGATCATTTCAAAAAAACGGAATGGAATTGGGCAAAGCGTCCAGTCTTGCCTTACCCTGAAAAAGTGTACCATCCGCTGGAATAACAAAAGAATCATTTGTAGGTGTTTCCAAAAAAAAGGCCGGTTGTGGGAAAAAAATAAAATCT
Full Trace Sequence: AATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGCCTCTGGAAAGGTTCCCACGGACCTGATTTAGTTGAGGTGTATGGCGCTCTATGGATCCTACTTGCCTTGTTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCACTTTAATGGACAAGGGGATTCCGGCTTTCCCGGTGCTGGAGGACAGCTCACTGGCAGAGAACATCACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGATGATGTTAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCCGCAAGAACCTTAAACTTACATACATAAATTTCTCCAGAAATAAGCTAACATCTTTAACCAAGAAGATTTTTCGCCATCTGACCTTATCTCAGCTGCTTCTTGGTGGCAATCCTTTCCAGTGCTCGTGTGATTTAATGTGGGTTAAAGTATTACTGGAGACTAATTCCCTGAACATGGAGAACCAAAATATACACTGCTTCAATGACAACAAAAAGAAGATTCCTCTCTTCAATATGCACATACCCAACTGTGGGTTGCCTATAGCAAATGTGAGTACGATAAATATCACAGTTCTTGAAGGTAATGAGACAACCCTGTACTGTGATGCCAACGGACTCCCAGACCCAAATGTCTCCTGGGATATCTCACAGATCATTTCAAAAAAACGGAATGGAATTGGGCAAAGCGTCCAGTCTTGCCTTACCCTGAAAAAGTGTACCATCCGCTGGAATAACAAAAGAATCATTTGTAGGTGTTTCCAAAAAAAAGGCCGGTTGTGGGAAAAAAATAAAATCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGCCTCTGGAAAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829122
dbEST ID: 79646824
Trimmed Sequence: CCCATTCAGAGGAACCGAATGAAACAAAACAAAACCCTTCAGACCAAACTTGGAGTGTCTTCCAAATTTCAGGATGATCAGCATTATTACTAGGCCAGTACAAACTAATGCTGCAATGCCCACTACAACGTAAACAGTGATACTGTCCTCATTTCCTCCATTGGAAACATCTGTGGAAGTGACTCCAGTTCCAATATCTGTACTAGTTCCCCCAATATCATTTGAAGTGGTTTCATAATCATAAAATCCGGGGTCAGTAATCGGATTACCGTCATCTGGACCTTTCATAAAAAGAGCACTTATGGATCTTTCATCCCTTCCATATATGTTCTCAGCCCTTAATGTATAAAATCCATTGTTCAAATGTGTTGGGCTGTCCAGTTGCAAACAGCCATGGTGCTCGCTTGTATAATTACTTGTTTCATGAATCTTGCTCCAAATGAAATCTGTCTCACTAAGAATATTCCCTTCATGGAACCACTGCAATGTAGGCTTTGGATTGCCCCTCACACTGAAAGGTATGCACCAATGATGGTCCAGCGTTGGCAGGTCAATAAAAGTGATCACTGGGGGGAGAGTGTACATTGAGTTCCACAGAGATATGATCTTCACCAACGCTGTTTTCTGCACACATANCATGATTCTTTTGNTTATCAGCGATGTTACATTTTTCAGGGTAAGCAAGACTGGACGCTTTGCCCATTTCCATCCGTTTTTTTTGAAATGATCCTTTAAAAAATCCCAGGGAAACATTTGGGGGGCTTGGGGAACTCG
Full Trace Sequence: CAGAGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCCATTCAGAGGAACCGAATGAAACAAAACAAAACCCTTCAGACCAAACTTGGAGTGTCTTCCAAATTTCAGGATGATCAGCATTATTACTAGGCCAGTACAAACTAATGCTGCAATGCCCACTACAACGTAAACAGTGATACTGTCCTCATTTCCTCCATTGGAAACATCTGTGGAAGTGACTCCAGTTCCAATATCTGTACTAGTTCCCCCAATATCATTTGAAGTGGTTTCATAATCATAAAATCCGGGGTCAGTAATCGGATTACCGTCATCTGGACCTTTCATAAAAAGAGCACTTATGGATCTTTCATCCCTTCCATATATGTTCTCAGCCCTTAATGTATAAAATCCATTGTTCAAATGTGTTGGGCTGTCCAGTTGCAAACAGCCATGGTGCTCGCTTGTATAATTACTTGTTTCATGAATCTTGCTCCAAATGAAATCTGTCTCACTAAGAATATTCCCTTCATGGAACCACTGCAATGTAGGCTTTGGATTGCCCCTCACACTGAAAGGTATGCACCAATGATGGTCCAGCGTTGGCAGGTCAATAAAAGTGATCACTGGGGGGAGAGTGTACATTGAGTTCCACAGAGATATGATCTTCACCAACGCTGTTTTCTGCACACATANCATGATTCTTTTGNTTATCAGCGATGTTACATTTTTCAGGGTAAGCAAGACTGGACGCTTTGCCCATTTCCATCCGTTTTTTTTGAAATGATCCTTTAAAAAATCCCAGGGAAACATTTGGGGGGCTTGGGGAACTCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCCATTCAGAGGAACCGA