ORFeome > nubp1 ORF2 – XORFeome v1.0

nubp1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nubp1
Gene ID: 992731
Gene Page ID: 992725
ORF Xenbase ID: 17287113

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106243
Original XGC clone length: 948

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ837944
dbEST ID: 79655646
Trimmed Sequence: ATGGCTGATATACCAGATAATGCACCCCAGCATTGCCCAGGTACAGACAGTACTGAGGCTGGCAAGAGTTCTGCGTGCCAGGGATGCCCCAATCAATCAATATGCGCATCAGGAGCTGCGGCAGGACCAGACCCAGCTATAGAAGAAATAAAAGAAAAAATGTCATTGGTTAAACACAAGATATTGGTTCTCTCTGGAAAGGGTGGTGTGGGCAAGAGTACATTCAGTGCCCACCTGGCACATGGTTTAGCCCAAGATGAGGGCAAAGAGGTGGCTCTGCTTGATGTGGACATCTGTGGACCATCGATTCCAAAAATGATGGGCTTGGAAGGAGAACAGGTTCACCAGAGTGGATCAGGATGGTCACCAGTGTATGTAGAAGATAACCTGGCTGTAATGTCTGTTGGATTCTTGCTTAGCAGTCCCGATGATGCGGTCATATGGAGAGGGCCTAAAAAAAATGGGATGATCAAACAGTTTTTGCGAGATGTGGACTGGGGTGATGTGGATTATCTGATAGTAGATACCCCTCCTGGTACATCAGACGAGCATCTTTCTGTAGTACAGTATCTCAATGCAGCAGGAATCGATGGAGCAGTAATCATTACAACTCCCCAAGAGGTCTCACTTCCGGATGTCCCAAAAGAAATCAACTTCTGCCGCAAATTAAACTTCCCATAAAAGTGTAATGAAAATATGAATTGGTTTTTTTTTTCTAATTTAAAAATGAATCCCAGATTTTTCCCCCACCTACCGGGGGGAACGAAAAAAGAGGGGCCGGGGACCACGGTGTTTCCTCTACTGGGCCCAAAATTTC
Full Trace Sequence: GGTGGGCCCAAATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGATATACCAGATAATGCACCCCAGCATTGCCCAGGTACAGACAGTACTGAGGCTGGCAAGAGTTCTGCGTGCCAGGGATGCCCCAATCAATCAATATGCGCATCAGGAGCTGCGGCAGGACCAGACCCAGCTATAGAAGAAATAAAAGAAAAAATGTCATTGGTTAAACACAAGATATTGGTTCTCTCTGGAAAGGGTGGTGTGGGCAAGAGTACATTCAGTGCCCACCTGGCACATGGTTTAGCCCAAGATGAGGGCAAAGAGGTGGCTCTGCTTGATGTGGACATCTGTGGACCATCGATTCCAAAAATGATGGGCTTGGAAGGAGAACAGGTTCACCAGAGTGGATCAGGATGGTCACCAGTGTATGTAGAAGATAACCTGGCTGTAATGTCTGTTGGATTCTTGCTTAGCAGTCCCGATGATGCGGTCATATGGAGAGGGCCTAAAAAAAATGGGATGATCAAACAGTTTTTGCGAGATGTGGACTGGGGTGATGTGGATTATCTGATAGTAGATACCCCTCCTGGTACATCAGACGAGCATCTTTCTGTAGTACAGTATCTCAATGCAGCAGGAATCGATGGAGCAGTAATCATTACAACTCCCCAAGAGGTCTCACTTCCGGATGTCCCAAAAGAAATCAACTTCTGCCGCAAATTAAACTTCCCATAAAAGTGTAATGAAAATATGAATTGGTTTTTTTTTTCTAATTTAAAAATGAATCCCAGATTTTTCCCCCACCTACCGGGGGGAACGAAAAAAGAGGGGCCGGGGACCACGGTGTTTCCTCTACTGGGCCCAAAATTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGATATACCAGATAATGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837943
dbEST ID: 79655645
Trimmed Sequence: CTTCTTTTTTTCACAATAGTCTTGAATTCTCTGGATTATTTTTCTGTAGGATAATGTTGCTGGGGAATCTGGAATTTCAGTAAAAAATGATTTCCCTGTGTCACAGCTCTTTCCTATATTTGGATCTAAGGGAACTTTGCCCAGTAGAGAAACACTGAGATCAGTGCACATCTTCTCTGCTCCCCCAGTAGTTGGAGGAAATATCTGTGATTCATTCTTACATTTAGGACAAATAAACCCACTCATATTTTCCACTACACCTATAATGGGAAGTTTTACTTTGCGGCAGAAGTTGATTTCTTTTCGGACATCCTGAAGTGAGACCTCTTGCGGAGTTGTAATGATTACTGCTCCATCGATTCCTGCTGCACTGAGATACTGTACTACAGAAAGATGCTCGTCTGATGTACCAGGAGGGGTATCTACTATCAGATAATCCACATCACCCCAGTCCACATCTCGCANAAACTGTTTGATCATCCCATTTTTTTTAGGCCCTCTCCATATGACCGCATCATCGGGACTGCTAAGCAAGAATCCCACAGACATTACAGCCCGGTTATCTTCTACTACACTGGTGACCATCCTGATCCACTCTGGTGAACCTGTTCTCCCTCCAAGCCCATCCTTTTTGGAAATCAATGGTTCACAAATGTCCCCATCAATCAAAACCACCTCTTTTCCCCTCCTCTGGGGCTTAAACCATGGGGCCGGGGGGGGCCGGGAGGGGGAAGCCTGGGCCGAGACCACCCCCCTTCCCGAAAAAAAAACAAA
Full Trace Sequence: AAAAGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCTTTTTTTCACAATAGTCTTGAATTCTCTGGATTATTTTTCTGTAGGATAATGTTGCTGGGGAATCTGGAATTTCAGTAAAAAATGATTTCCCTGTGTCACAGCTCTTTCCTATATTTGGATCTAAGGGAACTTTGCCCAGTAGAGAAACACTGAGATCAGTGCACATCTTCTCTGCTCCCCCAGTAGTTGGAGGAAATATCTGTGATTCATTCTTACATTTAGGACAAATAAACCCACTCATATTTTCCACTACACCTATAATGGGAAGTTTTACTTTGCGGCAGAAGTTGATTTCTTTTCGGACATCCTGAAGTGAGACCTCTTGCGGAGTTGTAATGATTACTGCTCCATCGATTCCTGCTGCACTGAGATACTGTACTACAGAAAGATGCTCGTCTGATGTACCAGGAGGGGTATCTACTATCAGATAATCCACATCACCCCAGTCCACATCTCGCANAAACTGTTTGATCATCCCATTTTTTTTAGGCCCTCTCCATATGACCGCATCATCGGGACTGCTAAGCAAGAATCCCACAGACATTACAGCCCGGTTATCTTCTACTACACTGGTGACCATCCTGATCCACTCTGGTGAACCTGTTCTCCCTCCAAGCCCATCCTTTTTGGAAATCAATGGTTCACAAATGTCCCCATCAATCAAAACCACCTCTTTTCCCCTCCTCTGGGGCTTAAACCATGGGGCCGGGGGGGGCCGGGAGGGGGAAGCCTGGGCCGAGACCACCCCCCTTCCCGAAAAAAAAACAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTTTTTTTCACAATAGTC