ORFeome > nudt16 ORF1 – XORFeome v1.0

nudt16 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nudt16
Gene ID: 6252278
Gene Page ID: 972482
ORF Xenbase ID: 17287179

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC141719
Original XGC clone length: 639

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ838876
dbEST ID: 79656578
Trimmed Sequence: ATGGCGGAAAGTAGGAGCCCAGACAGGGGGGCAAAGGAGGATAAGCCGCGGCCCCGAAACATATCCAGAGAAGAGTCTCTGCAGTTGGAAGGCTATAAGCACGCCTGTCATGCGCTGCTGCATGCACCTAGTCAAGCCAAGCTTTTCGACCGTGTCCCTATTAGGCGTGTATTGCTGATGATGATGCGCTTCGATGGACGCTTGGGATTCCCAGGTGGTTTTGTAGACACTCGAGACATATCTCTGGAAGAAGGTCTGAAACGGGAATTGGAAGAGGAACTGGGTCCTGCTCTCGCAACGGTGGAGGTGACAGAGGACGATTATAGAAGTTCCCAAGTCAGGGAACACCCTCAAAAGTGTGTTACTCACTTCTACATTAAGGAACTGAAACTTGAGGAAATAGAGAGGATTGAAGCTGAGGCCGTGAATGCGAAAGACCATGGATTAGAGGTGATGGGCCTGATCCGTGTGCCCCTGTATACCCTACGGGATCGAGTGGGAGGTCTTCCTGCATTCCTGTGCAACAACTTTATTGGGAACTCTAAAAGTCAACTTCTGTATGCACTACGCTCTTTGAAACTGCTACGGGAAGACCAGATTCAGGAGGTCCTGAGGGCGAGCCATAGACTTTATTACTT
Full Trace Sequence: GGGGGCCTTTAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAAAGTAGGAGCCCAGACAGGGGGGCAAAGGAGGATAAGCCGCGGCCCCGAAACATATCCAGAGAAGAGTCTCTGCAGTTGGAAGGCTATAAGCACGCCTGTCATGCGCTGCTGCATGCACCTAGTCAAGCCAAGCTTTTCGACCGTGTCCCTATTAGGCGTGTATTGCTGATGATGATGCGCTTCGATGGACGCTTGGGATTCCCAGGTGGTTTTGTAGACACTCGAGACATATCTCTGGAAGAAGGTCTGAAACGGGAATTGGAAGAGGAACTGGGTCCTGCTCTCGCAACGGTGGAGGTGACAGAGGACGATTATAGAAGTTCCCAAGTCAGGGAACACCCTCAAAAGTGTGTTACTCACTTCTACATTAAGGAACTGAAACTTGAGGAAATAGAGAGGATTGAAGCTGAGGCCGTGAATGCGAAAGACCATGGATTAGAGGTGATGGGCCTGATCCGTGTGCCCCTGTATACCCTACGGGATCGAGTGGGAGGTCTTCCTGCATTCCTGTGCAACAACTTTATTGGGAACTCTAAAAGTCAACTTCTGTATGCACTACGCTCTTTGAAACTGCTACGGGAAGACCAGATTCAGGAGGTCCTGAGGGCGAGCCATAGACTTTATTACTTGCCAACTTTCTTGTTACAAGTTTGCATTTTAAGAAAGCATTGCTTATAATTTTGTTGCAACGAACGGGTTACTATCAGTTCAAAATAAAACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAAAGTAGGAGCCCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838875
dbEST ID: 79656577
Trimmed Sequence: GTACTGAAGTCTATGGCTTGCCTTCAGGACCTCCTGAATCTGGTCCTCCCGTAGCAGTTTCAAAGAGCGTAGTGCATACAGAAGTTGACTTTTAGAGTTCCCAATAAAGTTGTTGCACAGGAATGCAGGAAGACCTCCCACTCGATCCCGTAGGGTATACAGGGGCACACGGATCAGGCCCATCACCTCTAATCCATGGTCTTTCGCATTCACGGCCTCAGCTTCAATCCTCTCTATTTCCTCAAGTTTCAGTTCCTTAATGTAGAAGTGAGTAACACACTTTTGAGGGTGTTCCCTGACTTGGGAACTTCTATAATCGTCCTCTGTCACCTCCACCGTTGCGAGAGCAGGACCCAGTTCCTCTTCCAATTCCCGTTTCAGACCTTCTTCCAGAGATATGTCTCGAGTGTCTACAAAACCACCTGGGAATCCCAAGCGTCCATCGAAGCGCATCATCATCAGCAATACACGCCTAAAAGGGACACGGTCGAAAAGCTTGGCTTGACTAGGTGCATGCAGCAGCGCATGACAGGCGTGCTTATAGCCTTCCAACTGCAGAGACTCTTCTCTGGATATGTTTCGGGGCCGCCGCTTATCCTCCCTTGCCCCCCTGTCTGGGCTCCTACTTTTCCCCCATGGTTGCCACTTTTTTTGTACCAAATTTGGCATTATAAAAAAACAATTGCTCCATCAATTTTTTTTCGACCAAAAAGGGTTCCTTAACAAAACAAACATAAAAATAAATA
Full Trace Sequence: GGGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTACTGAAGTCTATGGCTTGCCTTCAGGACCTCCTGAATCTGGTCCTCCCGTAGCAGTTTCAAAGAGCGTAGTGCATACAGAAGTTGACTTTTAGAGTTCCCAATAAAGTTGTTGCACAGGAATGCAGGAAGACCTCCCACTCGATCCCGTAGGGTATACAGGGGCACACGGATCAGGCCCATCACCTCTAATCCATGGTCTTTCGCATTCACGGCCTCAGCTTCAATCCTCTCTATTTCCTCAAGTTTCAGTTCCTTAATGTAGAAGTGAGTAACACACTTTTGAGGGTGTTCCCTGACTTGGGAACTTCTATAATCGTCCTCTGTCACCTCCACCGTTGCGAGAGCAGGACCCAGTTCCTCTTCCAATTCCCGTTTCAGACCTTCTTCCAGAGATATGTCTCGAGTGTCTACAAAACCACCTGGGAATCCCAAGCGTCCATCGAAGCGCATCATCATCAGCAATACACGCCTAAAAGGGACACGGTCGAAAAGCTTGGCTTGACTAGGTGCATGCAGCAGCGCATGACAGGCGTGCTTATAGCCTTCCAACTGCAGAGACTCTTCTCTGGATATGTTTCGGGGCCGCCGCTTATCCTCCCTTGCCCCCCTGTCTGGGCTCCTACTTTTCCCCCATGGTTGCCACTTTTTTTGTACCAAATTTGGCATTATAAAAAAACAATTGCTCCATCAATTTTTTTTCGACCAAAAAGGGTTCCTTAACAAAACAAACATAAAAATAAATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACTGAAGTCTATGGCTTG