ORFeome > nudt9 ORF1 – XORFeome v1.0

nudt9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nudt9
Gene ID: 6252786
Gene Page ID: 6457443
ORF Xenbase ID: 17287221

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123219
Original XGC clone length: 972

Human orthology & disease relationships

NCBI Entrez ID: 53343
Ensembl gene IDs: ENSG00000170502
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 248900,608611

Library Location

Plate ID: GDExl11088
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ838269
dbEST ID: 79655971
Trimmed Sequence: ATGTTGAGTCGGGGGCTGAGTCGTGGAGCTGTCGCCGTGTCCATCACTGCCGCTATAGCCGCCGTAGGCAGCAGCTTCCTGTATTCCCGCTGGTTCCGCCCCCTCGGCTCCTCCTCCTGCGCACGTTCAATGGCGGCTCATGTCAAGGCCCTCACCTCCCCATACCCAGGCTCCCAGGTGCAGCGCACCCCTGTACCCCCAGAGAAGATCTGCTGGCAAGTGGATTGGCCGGAATATGATCCTGTGGATTACACCGCCCCCTACGTACTGACCAATCCCCCATGGGCAGATCCACCACTGGGGAGTGAGGGATTCTCCCCCAAATTCAATGCCCTTGATGGTGCCGTGCAGAGACAGAGCCTACAGGACACATATAGCGTGGAGAAGGGGGTCCCCAGGAACCCTGTGGGACGGACTGGGGTTAAAGGAAGGGGACTGCTGGGGAGATGGGGACCCAATCATGCGGCCGACCCAATTATAACAAGGTGGAAACAGGACTCTGATGGGCGCCGAGTGACAGACGTGAACACTGGGAAGCCCATTCTGCAGTTTGTCGCTATACAGAGAAAAGACTGTGGGCCAGTGGCCATCCCCAGTGGCATGGTGGATCCCGGGGAGCTGGTGACGGCCACACTGCGCAGGGAGTTCTGCCAAGAGGCGCCCAATTCCCTGGAGGGGAGAGGGAATCAAGCGGAAAAGAAAAAAAAAACCACAAACCTTTTTCTCCCCCCGACCATTTTCGGAATATACAGGGGGTGATAGTGGGAGGAACCGGGGGAAAACACAACAAAATTCCAATTAAAATGTAAACACCCC
Full Trace Sequence: CGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGAGTCGGGGGCTGAGTCGTGGAGCTGTCGCCGTGTCCATCACTGCCGCTATAGCCGCCGTAGGCAGCAGCTTCCTGTATTCCCGCTGGTTCCGCCCCCTCGGCTCCTCCTCCTGCGCACGTTCAATGGCGGCTCATGTCAAGGCCCTCACCTCCCCATACCCAGGCTCCCAGGTGCAGCGCACCCCTGTACCCCCAGAGAAGATCTGCTGGCAAGTGGATTGGCCGGAATATGATCCTGTGGATTACACCGCCCCCTACGTACTGACCAATCCCCCATGGGCAGATCCACCACTGGGGAGTGAGGGATTCTCCCCCAAATTCAATGCCCTTGATGGTGCCGTGCAGAGACAGAGCCTACAGGACACATATAGCGTGGAGAAGGGGGTCCCCAGGAACCCTGTGGGACGGACTGGGGTTAAAGGAAGGGGACTGCTGGGGAGATGGGGACCCAATCATGCGGCCGACCCAATTATAACAAGGTGGAAACAGGACTCTGATGGGCGCCGAGTGACAGACGTGAACACTGGGAAGCCCATTCTGCAGTTTGTCGCTATACAGAGAAAAGACTGTGGGCCAGTGGCCATCCCCAGTGGCATGGTGGATCCCGGGGAGCTGGTGACGGCCACACTGCGCAGGGAGTTCTGCCAAGAGGCGCCCAATTCCCTGGAGGGGAGAGGGAATCAAGCGGAAAAGAAAAAAAAAACCACAAACCTTTTTCTCCCCCCGACCATTTTCGGAATATACAGGGGGTGATAGTGGGAGGAACCGGGGGAAAACACAACAAAATTCCAATTAAAATGTAAACACCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGAGTCGGGGGCTGAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838268
dbEST ID: 79655970
Trimmed Sequence: CCAGTGTGCCCCCCTCTTGTGTGCCAGGATGAGGATGAAGCTGGCATGGTTGGCATACAGACTGCACTCACTACTCACATCCACCCACTGAACCTTCCCTGCATCGTCCCCGGCTTCCAAGCGCAGCTGATTCAGGAGGTGCCCTGTCTCATCATGGTAATTCACAGCCTGGGTCTCCATCCATGAATTGTCTGTGTTCCGCGGGTCATCCACATACCCCTTGTATATCAGCAAATGCTCCTGGGAGAAAAGCTCCTGGATTTTCTTCTCATTTTCGGTTTGATCCCCTGTACCCTCCAGTGAATTGAGCGCCTCCTCGCAGAACTCCCTGCGCAGTGTGGCCGTCACCAGCTCCCCCGGATCCACCATGCCACCGGGGATGGCCCACTGGCCACAGTCTTTTCTCTGTATAGCGACAAACTGCAGAATGGGCTTCCCAGTGTTCACGTCTGTCACTCGGCGCCCATCACAGTCCTGTTTCGACCTTGTTATAATTGGGTCGGCCGCATGATTGGGTCCCCATCTCCCCAGCAGTCCCCTTCCTTTAACCCCAATCCGTCCCAAAGGGTTCCTGGGGACCCCCTTCTCCACGCTATATGTTTTCTGTAGGCTCTTGTCTCTGGCAGGGACCGTCAAGGGCATTGAAATTTGGGGGAAAAACGCTCACTTCCCACTTGGGTGATCCTGCCGAGGGGGGGATGGGGGAGGACGGAGGGGGGGGGGGGTGGGTCCGCAGGAATCAAAATCCACGCGCATCTCCAATTTCGC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCAGTGTGCCCCCCTCTTGTGTGCCAGGATGAGGATGAAGCTGGCATGGTTGGCATACAGACTGCACTCACTACTCACATCCACCCACTGAACCTTCCCTGCATCGTCCCCGGCTTCCAAGCGCAGCTGATTCAGGAGGTGCCCTGTCTCATCATGGTAATTCACAGCCTGGGTCTCCATCCATGAATTGTCTGTGTTCCGCGGGTCATCCACATACCCCTTGTATATCAGCAAATGCTCCTGGGAGAAAAGCTCCTGGATTTTCTTCTCATTTTCGGTTTGATCCCCTGTACCCTCCAGTGAATTGAGCGCCTCCTCGCAGAACTCCCTGCGCAGTGTGGCCGTCACCAGCTCCCCCGGATCCACCATGCCACCGGGGATGGCCCACTGGCCACAGTCTTTTCTCTGTATAGCGACAAACTGCAGAATGGGCTTCCCAGTGTTCACGTCTGTCACTCGGCGCCCATCACAGTCCTGTTTCGACCTTGTTATAATTGGGTCGGCCGCATGATTGGGTCCCCATCTCCCCAGCAGTCCCCTTCCTTTAACCCCAATCCGTCCCAAAGGGTTCCTGGGGACCCCCTTCTCCACGCTATATGTTTTCTGTAGGCTCTTGTCTCTGGCAGGGACCGTCAAGGGCATTGAAATTTGGGGGAAAAACGCTCACTTCCCACTTGGGTGATCCTGCCGAGGGGGGGATGGGGGAGGACGGAGGGGGGGGGGGGTGGGTCCGCAGGAATCAAAATCCACGCGCATCTCCAATTTCGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGTGTGCCCCCCTCTT