ORFeome > nufip1 ORF1 – XORFeome v1.0

nufip1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nufip1
Gene ID: 1015996
Gene Page ID: 1015990
ORF Xenbase ID: 17287227

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123380
Original XGC clone length: 1536

Human orthology & disease relationships

NCBI Entrez ID: 26747
Ensembl gene IDs: ENSG00000083635
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,151623,608089

Library Location

Plate ID: GDExl11085
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ837758
dbEST ID: 79655460
Trimmed Sequence: ATGGAGAACTTAAATCATTACCCGGCCCCGGGACTCAGACCTCCGATGTTTACAGCTGGGCCTTGCACAGGCCCACCACCAGTTCCATGGTTTCATTGTCCTCCACCTTCCCCTCAGGGGCTGTGGGGTGGAGGATGGAACCAGTGGCGACCCCAGTACAGGCAGCAGCAGCCGTCATACAGTGAGCAGCATGGAGGAGGGGGACATGGACATTTTAATCGTGAAAGCCGAATGCCATTTGGAAACGGTCAGAGTACAATGAAGAATCATTCGAAAAAGCAAAAGAAAGAACCCGTTTACACTCACTACTGTGACACATGTGACCGTGGTTTTAAAAACCAAGCAAAGTATAATGAACACACCTCTCATCATGTCAAGTGTGAAGAACCAGGCTGCAGTTTTAATGCCCATGAGAAGCTGGTACAGATTCACTGGAGAAATATGCATGCTCCTGGAGCTAAGAGAATTAAACTTGATACACCAGAAGAAATTGCAAAATGGAGAGAAGAAACAAGAAAAAATTTTCTAACACTAACAAACATTGCCAGGAAACAGCAGCTCCACAAAGAAAGGGAAGAACATGAAGACGTGTTGACAACCCCCCCTTTTGGGTTGGGAGAGGGGATAAGGAGAGCGAAGGTTAGTCTATCCGATCACGGTCCCAGGAATTGGCAACTTGCGCAAAACCAAAAAAATTTTCATGAAAACCATCCAAAAAAATCCAAAATTGTCACTTCAAGGTTGGCACC
Full Trace Sequence: GGAGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAACTTAAATCATTACCCGGCCCCGGGACTCAGACCTCCGATGTTTACAGCTGGGCCTTGCACAGGCCCACCACCAGTTCCATGGTTTCATTGTCCTCCACCTTCCCCTCAGGGGCTGTGGGGTGGAGGATGGAACCAGTGGCGACCCCAGTACAGGCAGCAGCAGCCGTCATACAGTGAGCAGCATGGAGGAGGGGGACATGGACATTTTAATCGTGAAAGCCGAATGCCATTTGGAAACGGTCAGAGTACAATGAAGAATCATTCGAAAAAGCAAAAGAAAGAACCCGTTTACACTCACTACTGTGACACATGTGACCGTGGTTTTAAAAACCAAGCAAAGTATAATGAACACACCTCTCATCATGTCAAGTGTGAAGAACCAGGCTGCAGTTTTAATGCCCATGAGAAGCTGGTACAGATTCACTGGAGAAATATGCATGCTCCTGGAGCTAAGAGAATTAAACTTGATACACCAGAAGAAATTGCAAAATGGAGAGAAGAAACAAGAAAAAATTTTCTAACACTAACAAACATTGCCAGGAAACAGCAGCTCCACAAAGAAAGGGAAGAACATGAAGACGTGTTGACAACCCCCCCTTTTGGGTTGGGAGAGGGGATAAGGAGAGCGAAGGTTAGTCTATCCGATCACGGTCCCAGGAATTGGCAACTTGCGCAAAACCAAAAAAATTTTCATGAAAACCATCCAAAAAAATCCAAAATTGTCACTTCAAGGTTGGCACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAACTTAAATCATTACCCG

Sequences - 3ʹ (reverse) EST

Accession: JZ837757
dbEST ID: 79655459
Trimmed Sequence: TACAATAGATGATTCACCAGAGATATTGGAGATCTCCCAAATTTCATCATCCACCTGAACAAGAGCTTCCTTCTTTTCAGCATCAAGTCTCTTACCCTGGTCACTATTCACAGAAGTATGTAATTCAGAGTTTTCTTGGCTATGACAACATTCCTTTTGACCCACAGCATCACTTGCTGAAACAGCAACAGCAGTTTCATGAGGCGTTCCACTCTCAGATATAATGTCCACAGGTTTATCAAAGAAGTCATTCTGAAGGATATACCGTACACACTGCAAAATCACATTCCTTTCATGCCTGATGTCATTAGCCAGTAACATTTCCAGAAGGGTGGGTTGGCATCTAATTGAAGCAGTGAATGGCTTCTTTCCATGTTTCCTGTGACTTTTGTTAGGGGGGATTTTACTGTGAGGTCCATTGCTCTGGTGCGCAGTGTGTTGGGTCTTTAATTCCTGTTCCGGCCTGTCACTTAATACTGTCTGAGCAGCAGTCGGCATGTGCGTCTGAAGAATCTGCTTATTCTTTTCCAAAGCGGCCTTAACACATCTAATGGGTTGTTCAATGGGTTCAGAGTCACTGTCGGAAGAGCTGCCATAGCTGCAGATAAGTTTGCTCAATGCAGACGTTACCTGCTTTGGAACTACTGACAACCCTGTGCTCACCTTTGCTTCATCGTTGTCCGATTCAGGATCACTGCCCCGCCATAAACTTAAGGGGGTCATAAGTGTCCCCCCTTTTGGGCCACATTTCCCTCTTGAAAATATTCTCTTTTTTTCTGTTTCAGCGTTTGAAGTTGCCACCTTTGATGGTACATTTGCAATTTTTTCTGACCTTTTTTCTTGAAATTTATTTGGGGTTCTGGCGGAGGGGGCCAGATTTTTGGAACCCTTTATTTGGTTTGACTAAACCGGCCGGTTCGTCCGCCCCTTCTCTTCTTCTCCAACTTCAAGGGTTGGTGAAGCGGGGGGGGCACGATAATCACCACTCCTTTTTCGGGACCTGCGTGCTGTCGGGCGGAGGGGGGTGCGAGTGGTGGGGAAGAAGTTGTGATTTTTGTTTGTTATTCCTCCCTCTTTTTGCTCTTTCCTTTCTCCGGGGTGTTGGAGGGGGGTGAAATTTTTGGCGGGGAGGGATCCAAGAGGAAACAAAACACAAAAATATTTGCACACCCAGGAGGGAAGACATGCATGGACCAACAACCCCTCCGTCTGGCCGGTGGGGGGGGGGCACGTTTT
Full Trace Sequence: GTGCCGGGGAACAGCCTATGAACCATGTACAACGACTCACTACTAGGGGAAACCAGCCTGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACAATAGATGATTCACCAGAGATATTGGAGATCTCCCAAATTTCATCATCCACCTGAACAAGAGCTTCCTTCTTTTCAGCATCAAGTCTCTTACCCTGGTCACTATTCACAGAAGTATGTAATTCAGAGTTTTCTTGGCTATGACAACATTCCTTTTGACCCACAGCATCACTTGCTGAAACAGCAACAGCAGTTTCATGAGGCGTTCCACTCTCAGATATAATGTCCACAGGTTTATCAAAGAAGTCATTCTGAAGGATATACCGTACACACTGCAAAATCACATTCCTTTCATGCCTGATGTCATTAGCCAGTAACATTTCCAGAAGGGTGGGTTGGCATCTAATTGAAGCAGTGAATGGCTTCTTTCCATGTTTCCTGTGACTTTTGTTAGGGGGGATTTTACTGTGAGGTCCATTGCTCTGGTGCGCAGTGTGTTGGGTCTTTAATTCCTGTTCCGGCCTGTCACTTAATACTGTCTGAGCAGCAGTCGGCATGTGCGTCTGAAGAATCTGCTTATTCTTTTCCAAAGCGGCCTTAACACATCTAATGGGTTGTTCAATGGGTTCAGAGTCACTGTCGGAAGAGCTGCCATAGCTGCAGATAAGTTTGCTCAATGCAGACGTTACCTGCTTTGGAACTACTGACAACCCTGTGCTCACCTTTGCTTCATCGTTGTCCGATTCAGGATCACTGCCCCGCCATAAACTTAAGGGGGTCATAAGTGTCCCCCCTTTTGGGCCACATTTCCCTCTTGAAAATATTCTCTTTTTTTCTGTTTCAGCGTTTGAAGTTGCCACCTTTGATGGTACATTTGCAATTTTTTCTGACCTTTTTTCTTGAAATTTATTTGGGGTTCTGGCGGAGGGGGCCAGATTTTTGGAACCCTTTATTTGGTTTGACTAAACCGGCCGGTTCGTCCGCCCCTTCTCTTCTTCTCCAACTTCAAGGGTTGGTGAAGCGGGGGGGGCACGATAATCACCACTCCTTTTTCGGGACCTGCGTGCTGTCGGGCGGAGGGGGGTGCGAGTGGTGGGGAAGAAGTTGTGATTTTTGTTTGTTATTCCTCCCTCTTTTTGCTCTTTCCTTTCTCCGGGGTGTTGGAGGGGGGTGAAATTTTTGGCGGGGAGGGATCCAAGAGGAAACAAAACACAAAAATATTTGCACACCCAGGAGGGAAGACATGCATGGACCAACAACCCCTCCGTCTGGCCGGTGGGGGGGGGGCACGTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACAATAGATGATTCACCAGAGAT