ORFeome > nup35 ORF1 – XORFeome v1.0

nup35 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nup35
Gene ID: 980947
Gene Page ID: 980940
ORF Xenbase ID: 17287245

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054165
Original XGC clone length: 858

Human orthology & disease relationships

NCBI Entrez ID: 129401
Ensembl gene IDs: ENSG00000163002
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 188550,231550,609192

Library Location

Plate ID: GDExl11001
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ839198
dbEST ID: 79656900
Trimmed Sequence: ATGATGGCTGCTGCTTTCTCCATGGAGCCTATGGGTGCTGAACCAATGGCACTTGGATCACCAACATCTCCAAAACCCAGTGCTGGTGCCCAATTCCTGCCTGGCTTTCTACTGGGGGACATACCAACACCAGTAACTCCACAGCCACGTCCATCTTTAGGCATAATGGAAGTGCGGTCACCTTTACATTCAGGTGGCTCACCCCCACAACCCGTACTACCTACTCATAAAGATAAGAGTGGAGCACCACCTGTTAGAAGCATATATGATGACGTTGCAAGTCCGGGTCTTGGTTCGACACCTCGGAATACAAGGAAGATGGCCAGCTTTTCTGTGTTGCACACTCCACTTTCTGGAGCTATACCATCAAGTCCAGCTTCAAATGTCTTTAGTCCTGCAACCATTGGGCAAAGCAGAAAAACCACCCTATCCCCTGCTCAGATGGATCCCTTTTATACTCAAGGTGATGCCCTGACTTCCGATGACCAGTTGGATGATACCTGGGTGACTGTGTTTGGGTTTCCACAAGCTTCTGCTTCTTATATTTTACTACAGTTTGCACAGTATGGGAACATCATAAAGCACGTGATGTCAAACAATGGCAACTGGATGCATATACAATATCAGTCAAAATTACCAGGCAAAAAAGCACTTAGTAAAAATGGAAGGAAATTTGGAGAAAGCATAATGAATTGGATTAAAAC
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGNACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGGCTGCTGCTTTCTCCATGGAGCCTATGGGTGCTGAACCAATGGCACTTGGATCACCAACATCTCCAAAACCCAGTGCTGGTGCCCAATTCCTGCCTGGCTTTCTACTGGGGGACATACCAACACCAGTAACTCCACAGCCACGTCCATCTTTAGGCATAATGGAAGTGCGGTCACCTTTACATTCAGGTGGCTCACCCCCACAACCCGTACTACCTACTCATAAAGATAAGAGTGGAGCACCACCTGTTAGAAGCATATATGATGACGTTGCAAGTCCGGGTCTTGGTTCGACACCTCGGAATACAAGGAAGATGGCCAGCTTTTCTGTGTTGCACACTCCACTTTCTGGAGCTATACCATCAAGTCCAGCTTCAAATGTCTTTAGTCCTGCAACCATTGGGCAAAGCAGAAAAACCACCCTATCCCCTGCTCAGATGGATCCCTTTTATACTCAAGGTGATGCCCTGACTTCCGATGACCAGTTGGATGATACCTGGGTGACTGTGTTTGGGTTTCCACAAGCTTCTGCTTCTTATATTTTACTACAGTTTGCACAGTATGGGAACATCATAAAGCACGTGATGTCAAACAATGGCAACTGGATGCATATACAATATCAGTCAAAATTACCAGGCAAAAAAGCACTTAGTAAAAATGGAAGGAAATTTGGAGAAAGCATAATGAATTGGATTAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGGCTGCTGCTTTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839197
dbEST ID: 79656899
Trimmed Sequence: TAAGTAGCAGCAAGGGGTCTCATGGATGCGGCTCTTGGAGTACCAACAGATTGTAGGAGTCCTTATGCTCTTTACTGGTGGTGTGAAAACTGATGACACAGAAGGTGTTGACACTTTTTCAGTGGCTTCCATTACACTCTTATCTATGCAAGGTTTTACTCCAATCATTATGCTTTCTCCAAATATCCTTCCATCTTTACTAAGTGCTTTTCTGGCCTGTAATTTTGACTGATATTGTATATGCATCCAGTTGCCATTGTTTGACATCACGTGCTTTATGATGTTCCCATACTGTGCAAACTGTAGTAAAATATAAGAAGCAGAAGCTTGTGGAAACCCAAACACAGTCACCCAGGTATCATCCAACTGGTCATCGGAAGTCAGGGCATCACCTTGAGTATAAAAGGGATCCATCTGAGCAGGGGATAGGGTGGTTTTTCTGCTTTGCCCAATGGTTGCAGGACTAAAGACATTTGAAGCTGGACTTGATGGTATAGCTCCAGAAAGTGGAGTGTGCAACACAGAAAAGCTGGCCATCTTCCTTGTATTCCGAGGTGTCGAACCAAAACCCCGAACTTGCAACGTCTCATATATGCTTTCTAAAAGGTGGTGGCTCCAGTCCTATCCTTATTAGTTAGGTAATACGGGTTTTTGGGGGGTAAAGCCACTGGAATAGTAAAGGGGGAACGCCCCTTTCCCTTTACGGCCTAAAAAGT
Full Trace Sequence: GACGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAGTAGCAGCAAGGGGTCTCATGGATGCGGCTCTTGGAGTACCAACAGATTGTAGGAGTCCTTATGCTCTTTACTGGTGGTGTGAAAACTGATGACACAGAAGGTGTTGACACTTTTTCAGTGGCTTCCATTACACTCTTATCTATGCAAGGTTTTACTCCAATCATTATGCTTTCTCCAAATATCCTTCCATCTTTACTAAGTGCTTTTCTGGCCTGTAATTTTGACTGATATTGTATATGCATCCAGTTGCCATTGTTTGACATCACGTGCTTTATGATGTTCCCATACTGTGCAAACTGTAGTAAAATATAAGAAGCAGAAGCTTGTGGAAACCCAAACACAGTCACCCAGGTATCATCCAACTGGTCATCGGAAGTCAGGGCATCACCTTGAGTATAAAAGGGATCCATCTGAGCAGGGGATAGGGTGGTTTTTCTGCTTTGCCCAATGGTTGCAGGACTAAAGACATTTGAAGCTGGACTTGATGGTATAGCTCCAGAAAGTGGAGTGTGCAACACAGAAAAGCTGGCCATCTTCCTTGTATTCCGAGGTGTCGAACCAAAACCCCGAACTTGCAACGTCTCATATATGCTTTCTAAAAGGTGGTGGCTCCAGTCCTATCCTTATTAGTTAGGTAATACGGGTTTTTGGGGGGTAAAGCCACTGGAATAGTAAAGGGGGAACGCCCCTTTCCCTTTACGGCCTAAAAAGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAGTAGCAGCAAGGGGT