ORFeome > nup43 ORF1 – XORFeome v1.0

nup43 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nup43
Gene ID: 1017300
Gene Page ID: 1017293
ORF Xenbase ID: 17287257

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123276
Original XGC clone length: 1128

Human orthology & disease relationships

NCBI Entrez ID: 348995
Ensembl gene IDs: ENSG00000120253
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 188550,231550,609192

Library Location

Plate ID: GDExl11091
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ838761
dbEST ID: 79656463
Trimmed Sequence: ATGGCCGATAAATTCGCAGCAAAATTTGTCTCTCACAAAATTAGCAGAACTCGTTGGCGGCCGGTGTCAGCCTCTTCGCTGCAGCAACCGGATGTGTTCGCAACCGGCTCCTGGGATAATGAGGAAAACAAGGTATGTGTGTGGGCCACTTCAGACTTTGGAGCCACAAGTCTTGATGAAGAATACCAAGGAGATCCTAAGCAACTGTGTGACATCAAGCACCCTGGTGATGTCATGGACATGCAGTTTTTAGATAAGGAGAGGATTGTAACCGGCTCGTCCACGGGAACTGTAACGATCTTTCGCCATCATGAAAACAATCAGACCTTATCCGTAAACCAAAGGTGGGAGCAGGCACATTATCATGTTGGATCAAACATGAGAGCCCCTTGCACTGCCATTGTATGTAGCAGTCCAGAAATTGTTTCTGTTGGGGAGGATGGCCGAATAAACTGTTTCCGTGCTGAGAGCAGAGATGTTTTGAGAACAATAGATGATGCAGACAGCAGTACAATGCATGGAGTAACATTTCTTCGCACGACAGAGATATTGACTGTAAATTCAGTAGGCCAGCTGAAATTGTGGGATTTAAGAAAGCAAGGCAATGATCCCACCCAGATCTTCTCCGTAACTGGTGAAAGAGTCCCTCTTCACTGTGTTGACCGTCCTCCTAAACAACAACATGGTTGTGGCAAACAGGTGGCCAGGGAGGGCCTGGCTTGGCAACCTGGGAATGTAAGAAAATGGACAAAATGCCAAATGTCCCCGGCCTAAAGGCTTCAGGAAAACACAAAAAAGGTGGG
Full Trace Sequence: TCGAGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGATAAATTCGCAGCAAAATTTGTCTCTCACAAAATTAGCAGAACTCGTTGGCGGCCGGTGTCAGCCTCTTCGCTGCAGCAACCGGATGTGTTCGCAACCGGCTCCTGGGATAATGAGGAAAACAAGGTATGTGTGTGGGCCACTTCAGACTTTGGAGCCACAAGTCTTGATGAAGAATACCAAGGAGATCCTAAGCAACTGTGTGACATCAAGCACCCTGGTGATGTCATGGACATGCAGTTTTTAGATAAGGAGAGGATTGTAACCGGCTCGTCCACGGGAACTGTAACGATCTTTCGCCATCATGAAAACAATCAGACCTTATCCGTAAACCAAAGGTGGGAGCAGGCACATTATCATGTTGGATCAAACATGAGAGCCCCTTGCACTGCCATTGTATGTAGCAGTCCAGAAATTGTTTCTGTTGGGGAGGATGGCCGAATAAACTGTTTCCGTGCTGAGAGCAGAGATGTTTTGAGAACAATAGATGATGCAGACAGCAGTACAATGCATGGAGTAACATTTCTTCGCACGACAGAGATATTGACTGTAAATTCAGTAGGCCAGCTGAAATTGTGGGATTTAAGAAAGCAAGGCAATGATCCCACCCAGATCTTCTCCGTAACTGGTGAAAGAGTCCCTCTTCACTGTGTTGACCGTCCTCCTAAACAACAACATGGTTGTGGCAAACAGGTGGCCAGGGAGGGCCTGGCTTGGCAACCTGGGAATGTAAGAAAATGGACAAAATGCCAAATGTCCCCGGCCTAAAGGCTTCAGGAAAACACAAAAAAGGTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGATAAATTCGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838760
dbEST ID: 79656462
Trimmed Sequence: TGAAAAGAGTCTTCTGGTAACATAAATTGCCTCTGCATCAGTTCCACAGACTAGGTTTTGCCCTAAAACATCCAGACTGTTCACAGACAGTGTTGAGCTTGGCAAGAGGTTGGTGATCTCTAGCTGGCCTTTAGTGGGGTCTGTACTAAGCCAAGCACAAGCCAAGGACTGGTTGGCATTAGGAGGAGCTATGCTGCTACGTGAAATGTTGAAGGTGCTCCTTCCCCCAAGGAGGAAGGTAGGCTTTTCAGAGTCAGCTGATGCATCCCAATGCCATAAGGAGCCATCTTCAGAGCAAGTAAACAGATGATCAGGATTGGATGGATGGAAATGCACCTCCCACATTTCTGCTTCATGAGCATTAAGCAGAGACATTGGCATTTTGCCATGTCTGACATCCCAGATGCAAAGCATGCCATCCTGGCCACCTGTTGCCACAACATGTTGTTGGTTAGGATGACGGTCAACACAGTGAAGAGGGACTCTTTCACCAGTTACGGAGAAGATCTGGGTGGGATCATTGCCTTGCTTTCTTAAATCCCACAACTTCAGCTGGCCTACTGAATTTACAGTCAATATCTCTGTCGTGCGAAGAAATGTTACTCCATGCATTGTACTGCTGTCTGCATCATCTATTGTTTCTCAAACATCTCTGCTCTCACCACGGGAAACAATTTATTCGGCCATCCTCCCCCAACAGAAACAAATTTCGGGACTGCTACCATACAAAGGGCAGTTGCAAAGGGGGCCTCCCAGGTTTTGAAACCACAAAAAA
Full Trace Sequence: GGGAAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGAAAAGAGTCTTCTGGTAACATAAATTGCCTCTGCATCAGTTCCACAGACTAGGTTTTGCCCTAAAACATCCAGACTGTTCACAGACAGTGTTGAGCTTGGCAAGAGGTTGGTGATCTCTAGCTGGCCTTTAGTGGGGTCTGTACTAAGCCAAGCACAAGCCAAGGACTGGTTGGCATTAGGAGGAGCTATGCTGCTACGTGAAATGTTGAAGGTGCTCCTTCCCCCAAGGAGGAAGGTAGGCTTTTCAGAGTCAGCTGATGCATCCCAATGCCATAAGGAGCCATCTTCAGAGCAAGTAAACAGATGATCAGGATTGGATGGATGGAAATGCACCTCCCACATTTCTGCTTCATGAGCATTAAGCAGAGACATTGGCATTTTGCCATGTCTGACATCCCAGATGCAAAGCATGCCATCCTGGCCACCTGTTGCCACAACATGTTGTTGGTTAGGATGACGGTCAACACAGTGAAGAGGGACTCTTTCACCAGTTACGGAGAAGATCTGGGTGGGATCATTGCCTTGCTTTCTTAAATCCCACAACTTCAGCTGGCCTACTGAATTTACAGTCAATATCTCTGTCGTGCGAAGAAATGTTACTCCATGCATTGTACTGCTGTCTGCATCATCTATTGTTTCTCAAACATCTCTGCTCTCACCACGGGAAACAATTTATTCGGCCATCCTCCCCCAACAGAAACAAATTTCGGGACTGCTACCATACAAAGGGCAGTTGCAAAGGGGGCCTCCCAGGTTTTGAAACCACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAAAAGAGTCTTCTGGTAACATA