ORFeome > nutf2 ORF1 – XORFeome v1.0

nutf2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nutf2
Gene ID: 952893
Gene Page ID: 952886
ORF Xenbase ID: 17287299

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054170
Original XGC clone length: 384

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ839146
dbEST ID: 79656848
Trimmed Sequence: ATGGCAGAAAAGCCAATTTGGGAGCAGATTGGAACAAGCTTTATACAACAATATTACCAGACATTTGACGCCGATAGGAACCAATTAGCAGTAATATATACTGATGCATCATGCCTTACGTGGGAAGGACAACAATATCATGGCAAAGCTGCAATTGTTGAAAAACTGTCGATGCTTCCCTTTCAGAAAATTCAGCATAGCATTACCTCACAAGATCATCAGCCCACTCCGGACAGTTGCATAATCAGTATGGTTGTTGGTCAACTCAAGGCTGATGATGACCCAGTTATGGGGTTTCATCAGGTATTTCTGCTAAAGAACATCCAAGACGCTTGGGTTTGTACAAATGACATGTTCCGACTAGCGCTGCATAACTTTGGCTT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAAAGCCAATTTGGGAGCAGATTGGAACAAGCTTTATACAACAATATTACCAGACATTTGACGCCGATAGGAACCAATTAGCAGTAATATATACTGATGCATCATGCCTTACGTGGGAAGGACAACAATATCATGGCAAAGCTGCAATTGTTGAAAAACTGTCGATGCTTCCCTTTCAGAAAATTCAGCATAGCATTACCTCACAAGATCATCAGCCCACTCCGGACAGTTGCATAATCAGTATGGTTGTTGGTCAACTCAAGGCTGATGATGACCCAGTTATGGGGTTTCATCAGGTATTTCTGCTAAAGAACATCCAAGACGCTTGGGTTTGTACAAATGACATGTTCCGACTAGCGCTGCATAACTTTGGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGGCGCACTAGACAGTGTCTCAGAATCTCTGAGGTTACAGAAAACGGCCGGGACGAATAGCTGAACGGCCCTGCTGGCAAGGAGAAAAAAAAGTAAATGGTGGTAGCGGGAAAAGCACACCCAACGGACAAAACCGGGGGGGGCGATGCAGTTTGGGAGCCCGTTCCCGCGGGGCCGGGGGGCAAGAAGTAACCAAACGGGGGGGGGAAGGAGCAGAGGGGGTATTAGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAAAGCCAATTTGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839145
dbEST ID: 79656847
Trimmed Sequence: GCCAAAGTTATGCAGCGCTAGTCGGAACATGTCATTTGTACAAACCCAAGCGTCTTGGATGTTCTTTAGCAGAAATACCTGATGAAACCCCATAACTGGGTCATCATCAGCCTTGAGTTGACCAACAACCATACTGATTATGCAACTGTCCGGAGTGGGCTGATGATCTTGTGAGGTAATGCTATGCTGAATTTTCTGAAAGGGAAGCATCGACAGTTTTTCAACAATTGCAGCTTTGCCATGATATTGTTGTCCTTCCCACGTAAGGCATGATGCATCANTATATATTACTGCTAATTGGTTCCTATCGGCGTCAAATGTCTGGTAATATTGTTGTATAAAGCTTGTTCCAATCTGCTCCCAAATTGGCTTTTCTGCCATGG
Full Trace Sequence: CGAGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAAGCCAAAGTTATGCAGCGCTAGTCGGAACATGTCATTTGTACAAACCCAAGCGTCTTGGATGTTCTTTAGCAGAAATACCTGATGAAACCCCATAACTGGGTCATCATCAGCCTTGAGTTGACCAACAACCATACTGATTATGCAACTGTCCGGAGTGGGCTGATGATCTTGTGAGGTAATGCTATGCTGAATTTTCTGAAAGGGAAGCATCGACAGTTTTTCAACAATTGCAGCTTTGCCATGATATTGTTGTCCTTCCCACGTAAGGCATGATGCATCANTATATATTACTGCTAATTGGTTCCTATCGGCGTCAAATGTCTGGTAATATTGTTGTATAAAGCTTGTTCCAATCTGCTCCCAAATTGGCTTTTCTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCCAAATAAAATCATTATTTGGCGTCCCGCCTAAAGACTGACCGTCGAGTCGCATCACCAGGACTGGGCTGTTTNCTGNCAGCTCTGGCCNGTGTCTCNAAATTCCGATAAAAAAAAANAAAANNANNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCAAAGTTATGCAGCGCTAGT