ORFeome > oat.2 ORF1 – XORFeome v1.0

oat.2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: oat.2
Gene ID: 1005712
Gene Page ID: 1005706
ORF Xenbase ID: 17287371

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045249
Original XGC clone length: 1320

Human orthology & disease relationships

NCBI Entrez ID: 4942
Ensembl gene IDs: ENSG00000065154
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 146800,194050,207800,207900,215700,238970,266140,311250,609924

Library Location

Plate ID: GDExl11013
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ824051
dbEST ID: 79641753
Trimmed Sequence: ATGCTTTCCAAACTAATCCAGAGACGCAGTGTGGGCGCTTTATTTGGCAACATCAAAGTATCTATGAGCTCTGCCACATCGGCTGCCACAGAGAAACCAGCAGAGGAAGCTTTATCATCTGAATATGTATTTGACCGGGAATCCAAATATGGGGCACACAACTACCACCCTCTGCCCGTTGCACTTGAAAGAGGAAAAGGTGTATATGTTTGGGATGTAGAAGGCAGGCGCTATTTTGATTTCCTCAGTGCCTACAGTGCTGTGAATCAGGGACACTGCCATCCAAAGATCCTCGATGCACTGAAGTCCCAGGCTGACAAACTCACGCTCACTTCCAGAGCTTTCTACAATGATGTGCTTGGTGAATATGAGGAATACATTACGAAGATCTTTGGCTACAACAAAGTGCTGCCCATGAACACAGGTGTTGAAGGCGGAGAAACTGCATGCAAGCTAGCCAGGAAGTGGGGCTACACCGTGAAAGGGATCCCCAAGTACAAGGCCCAGATCATCTTTGCAGCTGGGAACTTTTGGGGCAGGACAATGTCTGCGATATCGAGCTCTACAGACCCATCTAGCTACGAGGGCTTTGGACCATTTATGCCAGGCTTTAAAATTATTCCTTACAATGACCTTCCTGCTCTTGAGCGAGCACTACAAGACCCCAATGTTGCTGCTTTCATGGTTGAACCATCCAGGGGGAGGCTGGGTGTGATTGTTCAAGATGAAAGGTACCTTACAGGAGGTGCGGCAGCTCTGCACCGGGCACCCAATGTGCT
Full Trace Sequence: CATTATTGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTTTCCAAACTAATCCAGAGACGCAGTGTGGGCGCTTTATTTGGCAACATCAAAGTATCTATGAGCTCTGCCACATCGGCTGCCACAGAGAAACCAGCAGAGGAAGCTTTATCATCTGAATATGTATTTGACCGGGAATCCAAATATGGGGCACACAACTACCACCCTCTGCCCGTTGCACTTGAAAGAGGAAAAGGTGTATATGTTTGGGATGTAGAAGGCAGGCGCTATTTTGATTTCCTCAGTGCCTACAGTGCTGTGAATCAGGGACACTGCCATCCAAAGATCCTCGATGCACTGAAGTCCCAGGCTGACAAACTCACGCTCACTTCCAGAGCTTTCTACAATGATGTGCTTGGTGAATATGAGGAATACATTACGAAGATCTTTGGCTACAACAAAGTGCTGCCCATGAACACAGGTGTTGAAGGCGGAGAAACTGCATGCAAGCTAGCCAGGAAGTGGGGCTACACCGTGAAAGGGATCCCCAAGTACAAGGCCCAGATCATCTTTGCAGCTGGGAACTTTTGGGGCAGGACAATGTCTGCGATATCGAGCTCTACAGACCCATCTAGCTACGAGGGCTTTGGACCATTTATGCCAGGCTTTAAAATTATTCCTTACAATGACCTTCCTGCTCTTGAGCGAGCACTACAAGACCCCAATGTTGCTGCTTTCATGGTTGAACCATCCAGGGGGAGGCTGGGTGTGATTGTTCAAGATGAAAGGTACCTTACAGGAGGTGCGGCAGCTCTGCACCGGGCACCCAATGTGCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTTCCAAACTAATCCAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829361
dbEST ID: 79647063
Trimmed Sequence: GAAAGACAGCAGGGTTTTGTGGATGATTTCAGAGCACTCTCTAATCTCGTCTTCCTTGATGGTCAGTGGAGGAGCCAGCCGGATAATATCGCCATGGGTGGGTTTAGCTAAAAGCCCATTGTCACGTAGCCGAAGGCACACCTTCCATGCATCACAGTCTTTGCTTTGCTTTATGACAATGGCGTTCAGTAAGCCTTTCCCTCTTACAGCCGTCACTATGTCAGACGGAGTCTTCATCAGCTCCGCTCTCAACAGCTCTCCCATTGCATTTGCATTTTCTGCAAGCTTCTCCTCTTCAATGACCTCCAAAGAAGCCATAGCCACGCGACAAGCCAGAGGATTTCCGCCATAGGTAGACCCATGTTCTCCTGGTTTAATGGTCAGCATCACTTCATCATCACAGAGAACAGCAGATACTGGGTAAACCCCTCCAGATAGGGCCTTTCCAAGTATAACAAGATCAGGACGGACATTTTCATGGTCCACTGCCAGCATCTTCCCTGTTCTAGCCAGGCCTGTTTGTACTTCATCAGCAATAAATAGCACATTGTGTGCCGTGCAGAGCTGCCGCACTCCTGTTAGGTAACCTTCATCTGGGACAATCACACCCGCCCTCCCCCTGGATTGGTTCCACCCATGAAAGCCACCAACATTTGGGGGTCTTGTTGGTGGCTCGCCCCAAGAAGCAAGAAAGGGCCATTTGTAAGGGAAAATAATTTTTAAAAGCCCTGGGGAATAAAAGGGGGGCCCGAAAAGCCCC
Full Trace Sequence: CTGACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAAGACAGCAGGGTTTTGTGGATGATTTCAGAGCACTCTCTAATCTCGTCTTCCTTGATGGTCAGTGGAGGAGCCAGCCGGATAATATCGCCATGGGTGGGTTTAGCTAAAAGCCCATTGTCACGTAGCCGAAGGCACACCTTCCATGCATCACAGTCTTTGCTTTGCTTTATGACAATGGCGTTCAGTAAGCCTTTCCCTCTTACAGCCGTCACTATGTCAGACGGAGTCTTCATCAGCTCCGCTCTCAACAGCTCTCCCATTGCATTTGCATTTTCTGCAAGCTTCTCCTCTTCAATGACCTCCAAAGAAGCCATAGCCACGCGACAAGCCAGAGGATTTCCGCCATAGGTAGACCCATGTTCTCCTGGTTTAATGGTCAGCATCACTTCATCATCACAGAGAACAGCAGATACTGGGTAAACCCCTCCAGATAGGGCCTTTCCAAGTATAACAAGATCAGGACGGACATTTTCATGGTCCACTGCCAGCATCTTCCCTGTTCTAGCCAGGCCTGTTTGTACTTCATCAGCAATAAATAGCACATTGTGTGCCGTGCAGAGCTGCCGCACTCCTGTTAGGTAACCTTCATCTGGGACAATCACACCCGCCCTCCCCCTGGATTGGTTCCACCCATGAAAGCCACCAACATTTGGGGGTCTTGTTGGTGGCTCGCCCCAAGAAGCAAGAAAGGGCCATTTGTAAGGGAAAATAATTTTTAAAAGCCCTGGGGAATAAAAGGGGGGCCCGAAAAGCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAAGACAGCAGGGTTTTGTGGA