ORFeome > odc1 ORF1 – XORFeome v1.0

odc1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: odc1
Gene ID: 856383
Gene Page ID: 478944
ORF Xenbase ID: 17287401

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044004
Original XGC clone length: 1383

Human orthology & disease relationships

NCBI Entrez ID: 4953
Ensembl gene IDs: ENSG00000115758
Directly associated (OMIM) disease MIM numbers: 114500
Indirectly associated (Lage, et al.) disease MIM numbers: 146800,194050,207800,207900,215700,238970,266140,270200,311250,604232,607765,608643,609924

Library Location

Plate ID: GDExl11015
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGCCAACATGGTTTTATTTTTTTTTTTTTCTGTAGTGTAACTCTGACCCTGTTGTCGCAGATGTCTATGTAGCAGCGTCATTGTATATAGCTGCTAATTTTCTACTAAAAGATAGACCTACACCAGTGCAAATTCCTTGGACCCTATAACCGGGCTTCCTCCCATTACGCACCCTTGTCTTACAAATCATCTAGGGGAGATCAGCTTCTCGTGCGCCGGGGATATTATCGCGAACATAATAATCAATACCAAAATGTCGCTTCTTATGACACACCCAGAATATACTCTTTTTGCTTTCTCTATACTTGGGGCAACTTAGGGGAAAAAAGCCCGGGTCTTTGTATTTAAAAGACGACTCCCCTCCCCGCTTGCCGCGCTTTTTCATCCCCACAAAAAGAAAGGGGGGTGGGACAACAACATCTTCCGAAAAAGATCCATCAATGCTTGAAGCGCCGCGCGGTTAGCCCACCGGTGTTAAAAAAAGACAAAAACCTACTCCAACCAGAGAGAGTTACTGGGAGGCTCCCCACCCTGTTTGTTATATTAATTTACAACACCCCCTACAATAAACTTTCTCCCCCCTCACACACTACACCCCCCAAACAACGAGTGTTGGTAGGGGGAGGGAGAGGGTTTTTTTTTTTGTAAAATAAGATTGTTTTTGACAGTGGGGCGGTGGAAAAAAGAAAACACACCCGGAAAAAGAAAAGGATCCCTGACTCCCCCCCCCAATCTGCATCGGGACAATCACAACAAGAGTTGGTCTTGCTCCGGCCGCGGGGATATTCTACTTTTGTCGCTCCCCCACACTTAAATATATTGTCTCCTCCCTTGTTTTACTTGGTGGCGGAGAGGAAATAAATATAACAGAGGCGGGGAAAAGAAGGAGGAGTAAAAAAAAGTAATGATTTTGGGCCGGCCGCCCGGGGCGCCAGAAAACACGAAAATAAAAAAACACAGACCCCGCGGGGGAGAAAAAATAAAGTATGTGGGGGGGTGGTGGGGGTGCGGGGGAGGGGGGTTGTTTATTTTTTTTTTCTTATATTTTTTCTTTCTTTTCTTGTATGCGGGGTGGCGACCCGCCCCCCCACACCCCCGGCCGAACAGATGGGAGATAGGTGGGATAATATATGAGTAGGAAAAAGAACGCACATATAATACCCTTGAAAGCCCCTGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACAGCTTCAGCAATGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829655
dbEST ID: 79647357
Trimmed Sequence: TACATTGATGCTGGCAGCAGTACAGACAGCAGGTGCAAGTTCCATTCCGCTCTCCTGAGCACAGGATACATGGAGTGCACTCAGATCTGGTACTTCAGGGAGAATGCCATGTTCTTTAATATCATGCATCAGTTGCCAGTGTGGTCTTGACATAACATAATAAAGGGTTGGTCTCTGAAATCCATTGAATGTCGAGGCTGCAGCAACAGTGTAGGCACCCATGTTTTCAAACAACATCCAGTCTCCAACTTGCAGCTCCGGCAGCTCAAACCTTTCTACGATACGATCCAGCCCATCACACGTTGGTCCCCAAATGCTGCTCGAGTAGAACTTCTCATCTGGTTTGGGTTTCTTTGTTAGAACTGGCTTGACATGTGCATGATCAAACAAGATGCAGTTGAAAGATCCATACACTCCATCATTGACGTAGTACATCAGAGTTTTGTCATTGGCAGCATCTTCTTCATCATCAGATCCACTTTGCTCATTCACCATAACTTTCTTGGCAATGATATTAACTGCCAGGGTGAAAGATGAGGCAACATAGTATCTCCCAGGCTCTGCAATGATTTTAACGCCAGAATCTGCTGGGAAGTATTTATCCAGGGCTGGGTTTATCACAGATGTGATCTCTTTCAACTTCAGTTTCACATCCTCTGAACCCAGGGATCCCACACCAATATCAAAGTAAATGCATGGTAAAAGCCAAACTCAACCCCCCAGGTCAAAAAAACCCATCCGTGCATCCTTAAAAAGCCTTGGTA
Full Trace Sequence: CGGCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACATTGATGCTGGCAGCAGTACAGACAGCAGGTGCAAGTTCCATTCCGCTCTCCTGAGCACAGGATACATGGAGTGCACTCAGATCTGGTACTTCAGGGAGAATGCCATGTTCTTTAATATCATGCATCAGTTGCCAGTGTGGTCTTGACATAACATAATAAAGGGTTGGTCTCTGAAATCCATTGAATGTCGAGGCTGCAGCAACAGTGTAGGCACCCATGTTTTCAAACAACATCCAGTCTCCAACTTGCAGCTCCGGCAGCTCAAACCTTTCTACGATACGATCCAGCCCATCACACGTTGGTCCCCAAATGCTGCTCGAGTAGAACTTCTCATCTGGTTTGGGTTTCTTTGTTAGAACTGGCTTGACATGTGCATGATCAAACAAGATGCAGTTGAAAGATCCATACACTCCATCATTGACGTAGTACATCAGAGTTTTGTCATTGGCAGCATCTTCTTCATCATCAGATCCACTTTGCTCATTCACCATAACTTTCTTGGCAATGATATTAACTGCCAGGGTGAAAGATGAGGCAACATAGTATCTCCCAGGCTCTGCAATGATTTTAACGCCAGAATCTGCTGGGAAGTATTTATCCAGGGCTGGGTTTATCACAGATGTGATCTCTTTCAACTTCAGTTTCACATCCTCTGAACCCAGGGATCCCACACCAATATCAAAGTAAATGCATGGTAAAAGCCAAACTCAACCCCCCAGGTCAAAAAAACCCATCCGTGCATCCTTAAAAAGCCTTGGTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACATTGATGCTGGCAGCAGT