ORFeome > odf2l ORF1 – XORFeome v1.0

odf2l ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: odf2l
Gene ID: 948656
Gene Page ID: 948652
ORF Xenbase ID: 17287413

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC124909
Original XGC clone length: 1926

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ837485
dbEST ID: 79655187
Trimmed Sequence: ATGAAGACTCCAACATCAACTATCCAAACTAATGCTGCTACTGCTACACATGGAAACCTGGTCAGCACATCCAATGCAAATTTTTCTGAACACATGGATGAACGATCCTCAGTTTTAACCCAGGATACACAAGAGTTTCTAACAGATCTGTTGAACAGGCAAAAAACAAGGTTAAATGAGCTGTCATCCCACCTTTCCAGTATGGCACACTCTGAAACATTTCTTTCAAGCTTAAAAAGTAGCATGCATTGGCCAGTTGAAGAACTTACTTGTGATAAAGTTGTAACGTTACTGACAAAGCTCAAAGATACTGATGTAGCTGCTAATTCTGTTGAAACACTTATTGAGAAATTGAAGGATTCTTCAAGAGGTATACTGAGGGCCGATAATGTTTCTAGCTTGGATGCTATCGACATTTCAAAGCAAAATGATCTGCTCTGGAAAGAACTTGAAACATTCAGACATATTAGGGGAATTCTTGAATCCTTTCTTCAGACACATTATTCTAAGTCTAGCAGATTAATTAATCAGGAGAATTGTGGAAGTTTTTGATGGGACAACTGCTTGAACATGAAGAAGACAATTTAAGACTAATAGAACAAGTTGTAGAAAAAAAACAAAATGTTGATGATCTTTTGCACCTTATTCACCAAGAGAAGGATACTGCTGTGAAATCCAACCAATTTTCAAGAATCTACCGAGGCTACCCCTATTCTCCCTCCCAACCCTATTAAAAAAAAAAAAAAAAAAAAAAACAACAATATTGTCAACCCAAATAACAAAATTTCTTTCCAACCCATTCTTTT
Full Trace Sequence: TCGAGGCCCCAATAAATGATTTTATTTTGACTGATAGTGACCTGNTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGACTCCAACATCAACTATCCAAACTAATGCTGCTACTGCTACACATGGAAACCTGGTCAGCACATCCAATGCAAATTTTTCTGAACACATGGATGAACGATCCTCAGTTTTAACCCAGGATACACAAGAGTTTCTAACAGATCTGTTGAACAGGCAAAAAACAAGGTTAAATGAGCTGTCATCCCACCTTTCCAGTATGGCACACTCTGAAACATTTCTTTCAAGCTTAAAAAGTAGCATGCATTGGCCAGTTGAAGAACTTACTTGTGATAAAGTTGTAACGTTACTGACAAAGCTCAAAGATACTGATGTAGCTGCTAATTCTGTTGAAACACTTATTGAGAAATTGAAGGATTCTTCAAGAGGTATACTGAGGGCCGATAATGTTTCTAGCTTGGATGCTATCGACATTTCAAAGCAAAATGATCTGCTCTGGAAAGAACTTGAAACATTCAGACATATTAGGGGAATTCTTGAATCCTTTCTTCAGACACATTATTCTAAGTCTAGCAGATTAATTAATCAGGAGAATTGTGGAAGTTTTTGATGGGACAACTGCTTGAACATGAAGAAGACAATTTAAGACTAATAGAACAAGTTGTAGAAAAAAAACAAAATGTTGATGATCTTTTGCACCTTATTCACCAAGAGAAGGATACTGCTGTGAAATCCAACCAATTTTCAAGAATCTACCGAGGCTACCCCTATTCTCCCTCCCAACCCTATTAAAAAAAAAAAAAAAAAAAAAAACAACAATATTGTCAACCCAAATAACAAAATTTCTTTCCAACCCATTCTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGACTCCAACATCAACTATC

Sequences - 3ʹ (reverse) EST

Accession: JZ837484
dbEST ID: 79655186
Trimmed Sequence: TTCAAACATAGCGGCATAAGATGTTTTCAAAAACTGGACATAACTCTGGATGCTCTTGTTTCGGCTCTCTGTCATTTCAAGGCTGTGCCTTATTTCTTCCAAACGAAGATTATGGGTTTTCTCAAAAGCATTTAATGTGCAGCCAAGCTGTTTGTGTTCTGCCCTTTTCCTTTTCAGCTCACTTTCAAGGCTCTGCAATTTCCGCTGAAGAGCCAACTCTTTTGACAATACTTTATTGTTTTCTTCAGAAATCTGTTTGTTTCCCGCCTCCACAGCATTCTCAAGAAGTCTCATTAAAGTGCTACATTCTTTTGCTTTGCCTTCAAGTTCTACTTCACTCCGCTGTAGATCCCTTTCTTGGCCCTTTAATTTGGATTCAAGTTGCTCATTGTGCATGATCATCTTTTCTAATTTAATTCTTATCTCTTCACATTTTCTTTCAATACGATTATTTTCCAGCTTAAAAGACTCATTTCCAAGGAAATAATCATTCGTGTCAACCTTCTTATTTTCAGAGGCTTTATTTTCCAAGATTTCTTTCTTTTTTGGGAGAACATCTTTAAATTTTTCTTTAAGTTTATTCAGTTCTTCTG
Full Trace Sequence: CGGCGAAACAGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCATGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAAACATAGCGGCATAAGATGTTTTCAAAAACTGGACATAACTCTGGATGCTCTTGTTTCGGCTCTCTGTCATTTCAAGGCTGTGCCTTATTTCTTCCAAACGAAGATTATGGGTTTTCTCAAAAGCATTTAATGTGCAGCCAAGCTGTTTGTGTTCTGCCCTTTTCCTTTTCAGCTCACTTTCAAGGCTCTGCAATTTCCGCTGAAGAGCCAACTCTTTTGACAATACTTTATTGTTTTCTTCAGAAATCTGTTTGTTTCCCGCCTCCACAGCATTCTCAAGAAGTCTCATTAAAGTGCTACATTCTTTTGCTTTGCCTTCAAGTTCTACTTCACTCCGCTGTAGATCCCTTTCTTGGCCCTTTAATTTGGATTCAAGTTGCTCATTGTGCATGATCATCTTTTCTAATTTAATTCTTATCTCTTCACATTTTCTTTCAATACGATTATTTTCCAGCTTAAAAGACTCATTTCCAAGGAAATAATCATTCGTGTCAACCTTCTTATTTTCAGAGGCTTTATTTTCCAAGATTTCTTTCTTTTTTGGGAGAACATCTTTAAATTTTTCTTTAAGTTTATTCAGTTCTTCTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAAACATAGCGGCATAAGATG