ORFeome > odf3 ORF1 – XORFeome v1.0

odf3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: odf3
Gene ID: 6079195
Gene Page ID: 5889413
ORF Xenbase ID: 17287419

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041210
Original XGC clone length: 771

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ823582
dbEST ID: 79641284
Trimmed Sequence: ATGGGCACTGACTTATGGGTGGGAACCTGGAGACCCCATAGACCACGGGGTCCCATTGCAGCTTTCTACAGCAGCCCAGGACCCAAATATTCACTACCAGGAAATACAGGTTTTGTCAGTCATGATCCCAGTCGACATCGTGCTCCGGCTTATAGCATGGGGAACCGCCGTTTCAAGTTAGTTGATGACTGTTCACCAGGACCAGGATATTTGGTGCCATCTAATATCACTGTAAAGGGGAAGGATGGAACCCCTGCTTATTCCATCTATGGAAGACCAAGGGACATCTCCTCCTTTAGGACCCCAGGGCCAGGTAGTTATTCTCCAGAGCGTGCTGGGAAATCTGCATACCGCTCAGCTCCAACATACTCACTTGGTGAAAGAACAAAGACATTCGGCAATGACCAGACACCAGGTCCAGCAGCATATATGCTCCCCTCTGTGATTGGGCCAAGGATAGTGAACCGATCCTCTGCTCCAAACTACTCTATGACTGGACGGAGCAAAATTGGTAGCTTCCATGAAGACCTGCAGAAAACACCTGGTCCTGGGACATATCGTGTTATAGATCCTGGTACATATAAACACAAACCTCCCCAATACAGTATGACTGCCCGAAATGTTTTGCCTGGTGATACCACAATAAAACCAGGCCCAGGAGCCTACAGCCCAGAANAGGTGGTCATGTCAAAGGCTCAGGCTCCNAACTTCTCTTTTGGTATTCGGCACTCAGAATACGTTGCTCCCCTGATCGTGGATGTAGCAGACTTGCCCACTTTTN
Full Trace Sequence: CAATAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCACTGACTTATGGGTGGGAACCTGGAGACCCCATAGACCACGGGGTCCCATTGCAGCTTTCTACAGCAGCCCAGGACCCAAATATTCACTACCAGGAAATACAGGTTTTGTCAGTCATGATCCCAGTCGACATCGTGCTCCGGCTTATAGCATGGGGAACCGCCGTTTCAAGTTAGTTGATGACTGTTCACCAGGACCAGGATATTTGGTGCCATCTAATATCACTGTAAAGGGGAAGGATGGAACCCCTGCTTATTCCATCTATGGAAGACCAAGGGACATCTCCTCCTTTAGGACCCCAGGGCCAGGTAGTTATTCTCCAGAGCGTGCTGGGAAATCTGCATACCGCTCAGCTCCAACATACTCACTTGGTGAAAGAACAAAGACATTCGGCAATGACCAGACACCAGGTCCAGCAGCATATATGCTCCCCTCTGTGATTGGGCCAAGGATAGTGAACCGATCCTCTGCTCCAAACTACTCTATGACTGGACGGAGCAAAATTGGTAGCTTCCATGAAGACCTGCAGAAAACACCTGGTCCTGGGACATATCGTGTTATAGATCCTGGTACATATAAACACAAACCTCCCCAATACAGTATGACTGCCCGAAATGTTTTGCCTGGTGATACCACAATAAAACCAGGCCCAGGAGCCTACAGCCCAGAANAGGTGGTCATGTCAAAGGCTCAGGCTCCNAACTTCTCTTTTGGTATTCGGCACTCAGAATACGTTGCTCCCCTGATCGTGGATGTAGCAGACTTGCCCACTTTTN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCACTGACTTATGGGTGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ828880
dbEST ID: 79646582
Trimmed Sequence: GTCTGCTACATCCACGATCAGGGGAGCAACGTATTCTGAGTGCCGAATACCAAAAGAGAAGTTTGGAGCCTGAGCCTTTGACATGACCACCTTTTCTGGGCTGTAGGCTCCTGGGCCTGGTTTTATTGTGGTATCACCAGGCAAAACATTTCGGGCAGTCATACTGTATTGGGGAGGTTTGTGTTTATATGTACCAGGATCTATAACACGATATGTCCCAGGACCAGGTGTTTTCTGCAGGTCTTCATGGAAGCTACCAATTTTGCTCCGTCCAGTCATAGAGTAGTTTGGAGCAGAGGATCGGTTCACTATCCTTGGCCCAATCACAGAGGGGAGCATATATGCTGCTGGACCTGGTGTCTGGTCATTGCCGAATGTCTTTGTTCTTTCACCAAGTGAGTATGTTGGAGCTGAGCGGTATGCAGATTTCCCAGCACGCTCTGGAGAATAACTACCTGGCCCTGGGGTCCTAAAGGAGGAGATGTCCCTTGGTCTTCCATAGATGGAATAAGCAGGGGTTCCATCCTTCCCCTTTACAGGGATATAGATGGCACCAAATAACCTGGTCCTGGTGAACAGTCATCAACTAACTTGAAACGGCGGTTCCCCATGCTATAAGCCGGGAACACGATGTCCGCTGGGGATCAGGACTGACAAATACCTGTATTTTCCTGGGAATGGAAATATTTGGGTCCCGGGGGCG
Full Trace Sequence: GTCCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTGCTACATCCACGATCAGGGGAGCAACGTATTCTGAGTGCCGAATACCAAAAGAGAAGTTTGGAGCCTGAGCCTTTGACATGACCACCTTTTCTGGGCTGTAGGCTCCTGGGCCTGGTTTTATTGTGGTATCACCAGGCAAAACATTTCGGGCAGTCATACTGTATTGGGGAGGTTTGTGTTTATATGTACCAGGATCTATAACACGATATGTCCCAGGACCAGGTGTTTTCTGCAGGTCTTCATGGAAGCTACCAATTTTGCTCCGTCCAGTCATAGAGTAGTTTGGAGCAGAGGATCGGTTCACTATCCTTGGCCCAATCACAGAGGGGAGCATATATGCTGCTGGACCTGGTGTCTGGTCATTGCCGAATGTCTTTGTTCTTTCACCAAGTGAGTATGTTGGAGCTGAGCGGTATGCAGATTTCCCAGCACGCTCTGGAGAATAACTACCTGGCCCTGGGGTCCTAAAGGAGGAGATGTCCCTTGGTCTTCCATAGATGGAATAAGCAGGGGTTCCATCCTTCCCCTTTACAGGGATATAGATGGCACCAAATAACCTGGTCCTGGTGAACAGTCATCAACTAACTTGAAACGGCGGTTCCCCATGCTATAAGCCGGGAACACGATGTCCGCTGGGGATCAGGACTGACAAATACCTGTATTTTCCTGGGAATGGAAATATTTGGGTCCCGGGGGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTGCTACATCCACGAT