ORFeome > ogfod3 ORF1 – XORFeome v1.0

ogfod3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ogfod3
Gene ID: 6252751
Gene Page ID: 6457974
ORF Xenbase ID: 17287443

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC124985
Original XGC clone length: 879

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ837547
dbEST ID: 79655249
Trimmed Sequence: ATGAGCCCTAAGAAGAACAGAGGGCGCACACGCTGGAAAAGTCTGCTAATATGGGGAGTATTTGGCGTGACCTTGGGCCTTGTCTCTGGCTACTTTCTCTGGGGAGACCTGATCACTGATAACAGTGTGACTGAGGTGTTGGCAGCACAGCGCGACACTGTAGAGCACAGATTCTTTCAAGTGCCTTGCTCACAGGATTATGAGAGCCTCAAGCATTTTGAAGCTTGCACACCAAGGAAATGCGGACGAGCCATGACAGACTCTGTTATAACACTCCAGGAGGCTCAGAAGATGCGCAGATTAGCTGAGGCTGGCCTCTCTCTTGGAGGATCCGATGGAGGGGCTTCCATCCTAGACTTGCACTCAGGGGCCCTGTCAATGGGAAAGAAATTTGTAAATATGTACCGGTTCTTTGGAGAAAAAATCAAAGATGTCATGTCTGAGGAAGACTTTAAGCTGTATCGTGAGGTGCGACTGAAGATCCAGCACGAAATTGCAAGAACCTTCAATATTAGTGTCTCCTCCCTTCACCTCACCAAACCCACATTCTTCTCACGCATGAACAGCTCAGAAGCGAAAACCTCTCACGATGAATACTGGCACCCCCATATTGACCAGGTGACTTACGGTTCATTTGACTACACATCCTTGCTCTACCTCTCCGATTACTCCCAAAATTTTTGCGGGGGGAAGCTTTTGTGTTTCTTCGGTTAAAAATGCAAACAAAAAAATTGAAAACCTCCAAACTGGTTCCCGGTTTTCGTTTCTTTTTACTTTTTT
Full Trace Sequence: CGCGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCCCTAAGAAGAACAGAGGGCGCACACGCTGGAAAAGTCTGCTAATATGGGGAGTATTTGGCGTGACCTTGGGCCTTGTCTCTGGCTACTTTCTCTGGGGAGACCTGATCACTGATAACAGTGTGACTGAGGTGTTGGCAGCACAGCGCGACACTGTAGAGCACAGATTCTTTCAAGTGCCTTGCTCACAGGATTATGAGAGCCTCAAGCATTTTGAAGCTTGCACACCAAGGAAATGCGGACGAGCCATGACAGACTCTGTTATAACACTCCAGGAGGCTCAGAAGATGCGCAGATTAGCTGAGGCTGGCCTCTCTCTTGGAGGATCCGATGGAGGGGCTTCCATCCTAGACTTGCACTCAGGGGCCCTGTCAATGGGAAAGAAATTTGTAAATATGTACCGGTTCTTTGGAGAAAAAATCAAAGATGTCATGTCTGAGGAAGACTTTAAGCTGTATCGTGAGGTGCGACTGAAGATCCAGCACGAAATTGCAAGAACCTTCAATATTAGTGTCTCCTCCCTTCACCTCACCAAACCCACATTCTTCTCACGCATGAACAGCTCAGAAGCGAAAACCTCTCACGATGAATACTGGCACCCCCATATTGACCAGGTGACTTACGGTTCATTTGACTACACATCCTTGCTCTACCTCTCCGATTACTCCCAAAATTTTTGCGGGGGGAAGCTTTTGTGTTTCTTCGGTTAAAAATGCAAACAAAAAAATTGAAAACCTCCAAACTGGTTCCCGGTTTTCGTTTCTTTTTACTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCCTAAGAAGAACAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837546
dbEST ID: 79655248
Trimmed Sequence: TGTCCAGCTTGGGTCCCCGATGGCATGTTCAGGATCGCAGGTGAAAGAGATGGTTATAGCATATCGCGTCCCCCAATTCACTTTTTCCACCCGGTGAAGATTCTCTGATCCAGAAGTAAAGAATGAAACGCGACCAGTTCGAGGTTCCACTGTTCTGTTTGCACTTTCATCGATGAACACAAAGCGTCCCCCGCCAAAATCTTGGGAGTAATCGGAGAGGTAGAGCAAGGATGTGTAGTCAAATGAACCGTAAGTCACCTTGTCAATATGGGGGTGCCAGTATTCATCGTGAGAGGTTTTCGCTTCTGAGCTGTTCATGCGTGAGAAGAATGTGGGTTTGGTGAGGTGAAGGGAGGAGACACTAATATTGAAGGTTCTTGCAATTTCGTGCTGGATCTTCAGTCGCACCTCACGATACAGCTTAGAGTCTTCCTCAGACATGACATCTTTGATTTTTTCTCCAAAGAACCGGTACATATTTACAAATTTCTTTCCCATTGACAGGGCCCCTGAGTGCAAGTCTTGGATGGAAACCCCTCCATCGGATCCTCCAAAAGAGAGGCCAGCCCCAGCTAATCTGCCCCTCCTCTGAACCTCCTGGAATGTTATAGAAAAGTTCTTCATGGGTCGTCCGCTTTCCCTGGGTGTGGAGGCGTTCGAATCTTTAAGGCTGCCAAAAGCCCGTAAAAAGGGGCATGGAAAGAAGCGTGTTCTTCTAAAGATGTCCCCCCTTTTTCCTTGCCCAACGCGCTCAT
Full Trace Sequence: GGGAAAAGGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTCCAGCTTGGGTCCCCGATGGCATGTTCAGGATCGCAGGTGAAAGAGATGGTTATAGCATATCGCGTCCCCCAATTCACTTTTTCCACCCGGTGAAGATTCTCTGATCCAGAAGTAAAGAATGAAACGCGACCAGTTCGAGGTTCCACTGTTCTGTTTGCACTTTCATCGATGAACACAAAGCGTCCCCCGCCAAAATCTTGGGAGTAATCGGAGAGGTAGAGCAAGGATGTGTAGTCAAATGAACCGTAAGTCACCTTGTCAATATGGGGGTGCCAGTATTCATCGTGAGAGGTTTTCGCTTCTGAGCTGTTCATGCGTGAGAAGAATGTGGGTTTGGTGAGGTGAAGGGAGGAGACACTAATATTGAAGGTTCTTGCAATTTCGTGCTGGATCTTCAGTCGCACCTCACGATACAGCTTAGAGTCTTCCTCAGACATGACATCTTTGATTTTTTCTCCAAAGAACCGGTACATATTTACAAATTTCTTTCCCATTGACAGGGCCCCTGAGTGCAAGTCTTGGATGGAAACCCCTCCATCGGATCCTCCAAAAGAGAGGCCAGCCCCAGCTAATCTGCCCCTCCTCTGAACCTCCTGGAATGTTATAGAAAAGTTCTTCATGGGTCGTCCGCTTTCCCTGGGTGTGGAGGCGTTCGAATCTTTAAGGCTGCCAAAAGCCCGTAAAAAGGGGCATGGAAAGAAGCGTGTTCTTCTAAAGATGTCCCCCCTTTTTCCTTGCCCAACGCGCTCAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTCCAGCTTGGGTCCCCGAT