ORFeome > olfm1 ORF1 – XORFeome v1.0

olfm1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: olfm1
Gene ID: 866096
Gene Page ID: 491790
ORF Xenbase ID: 17287467

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108812
Original XGC clone length: 1458

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ837669
dbEST ID: 79655371
Trimmed Sequence: ATGTCTGTGCCTTTACTTAAGATTGGGGTTGTCCTGAGCACTATGGCTATGATCAGCAACTGGATGTCGCAGACCCTGCCCTCCCTGGTGGGTCTCAACACCACCAAGTTAATGGCAGCCAATGCAGGAACCTTGGATAGGAGCACAGGGGTTTTGCCAACCAACCCAGAAGAGAGCTGGCAAGTGTACAGCTCTGCCCAGGACAGCGAAGGGCGGTGTATATGCACAGTGGTGGCACCTCAACAGACAATGTGCTCACGGGATGCCAGGACAAAACAGCTCAGGCAGCTATTAGAAAAGGTGCAAAACATGTCTCAGTCAATAGAAGTATTGGACAGGCGGACCCAGCGGGACCTGCAATACGTAGAGAGAATGGAAAACCAAATGAAGGGCCTGGAATCTAAGTTCAAACAAGTGGAAGAAACACATAGGCAACACCAAGCCAGGCAGTTTAAGGCAATAAAAGCGAAAATGGAGGAGCTTAGGCCTCTGATACCAGTGTTGGAAGAGTACAAAGCCGATGCCAAATTGGTATTGCAGTTTAAAGAGGAGATCCAAAATCTGACGTCAGTTCTTAACGAACTTCAAGGAGGAGATTGGCGCCTATGACTACAACGAACTGCAGAGCAGAATGTCCAAATCTTGAAGAAAAGGCTCCTTTCCTTCCTTCAAAATTTTCCATGGCGGCAACCTTCCAGGAAATCAGCGGAACCTGTCGACATTAAG
Full Trace Sequence: CGCGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGTGCCTTTACTTAAGATTGGGGTTGTCCTGAGCACTATGGCTATGATCAGCAACTGGATGTCGCAGACCCTGCCCTCCCTGGTGGGTCTCAACACCACCAAGTTAATGGCAGCCAATGCAGGAACCTTGGATAGGAGCACAGGGGTTTTGCCAACCAACCCAGAAGAGAGCTGGCAAGTGTACAGCTCTGCCCAGGACAGCGAAGGGCGGTGTATATGCACAGTGGTGGCACCTCAACAGACAATGTGCTCACGGGATGCCAGGACAAAACAGCTCAGGCAGCTATTAGAAAAGGTGCAAAACATGTCTCAGTCAATAGAAGTATTGGACAGGCGGACCCAGCGGGACCTGCAATACGTAGAGAGAATGGAAAACCAAATGAAGGGCCTGGAATCTAAGTTCAAACAAGTGGAAGAAACACATAGGCAACACCAAGCCAGGCAGTTTAAGGCAATAAAAGCGAAAATGGAGGAGCTTAGGCCTCTGATACCAGTGTTGGAAGAGTACAAAGCCGATGCCAAATTGGTATTGCAGTTTAAAGAGGAGATCCAAAATCTGACGTCAGTTCTTAACGAACTTCAAGGAGGAGATTGGCGCCTATGACTACAACGAACTGCAGAGCAGAATGTCCAAATCTTGAAGAAAAGGCTCCTTTCCTTCCTTCAAAATTTTCCATGGCGGCAACCTTCCAGGAAATCAGCGGAACCTGTCGACATTAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGTGCCTTTACTTAAGATT

Sequences - 3ʹ (reverse) EST

Accession: JZ837668
dbEST ID: 79655370
Trimmed Sequence: CAATTCATCGGATCGAATGACATGAAAGAGGGTGACATTGTAGAGAATTTGGTGCCCGTTGTTCCAAGCATACAAGGCCCTGTCCTTGGGGTTGTAGTCCAACATGGAGATGTGTGAGTAGAGGTTGTGGAAAGGAATGTCAATATATTCATAGTTGGATGTGTTGGTTTGATAAGCATAGTGTACTTTGGTGCCACCTGAATAACCATTGGTGACATAGAGAGTCCCACAAATCATAAAGGCCTCACCAGCACTCCTCTTAGGATAACCTGTGTTCCATGTTTTGAGGATTTGCAGTGTATTAGGATCCAGCTTGCTGATGACTATGTTACCAGCATTTTGATTTGTGGCATAAACAACCCACAATCCATTTTCATCCACCATGAGGTCAATGTCCGACTGTCCTCCCCAAGCATAGTGATAAACGTTGGTGTAGCCAGCCGAATCCAAGCTACGGGTCTTCAGTATTGTCTCTGATTTCAAGTCAAACCTGATGATGATGTGGCTTTGGAATTTGTTGAAATATATGGAACCATTGTAGACCACCTGCCCGGTCCCAGACCATGGATGCGGGAGGCGGTGAGAGGTAAAGTTGTCGGTATTCCTGAAATCTTGCATGGATTTGGAATCCCGAACAAATCTATTGTTTGTGGAACCATCCATACTACCAAATCTGTTTGCTCCGTCGGGAACGAGAGGAGCAGCATCCCGCAACCAAAACTGCAACCCGAAGTCTTTTATGGGAAGGGGTTGGCTAGTCCTGTGAGACTGCCGGAGGCCTATTATTGCATAATGCCACGAAGCCGTCCTTGAAATTTTAACCGCGGCTCCGCAGTGGCTCGGAACATAGGGCCCAGTCGCGGCGGTTAAGTTGTTTTAAGTAAACGTCAAATTCGGGATTCCGCGCTGGAGGTCGGAAACAAATTGGGGGCGAGCTTTGTGCGCTTACGGCCCGTGGAAAGGAAGAGGGGGGCGGGCGCAGGTGTGCCCTTTTATGGCCTTAGAACGGCCAGGGGGGGGGGGGTGGGGCGGGGTGGGGGGGGTGGCGGTGTGGTGTGGAGGATGCAATAACACAGGGGGCGCTAGAGAAGGAGGTGGTGGCGGGGTTGTTGCTGGGGGAGGAGTGAGGGTTGCAGCCCCGCGTCTGCGAGACGGCGGCCGGGAGGGGGCGCGGAGTGGGGTGGGGGTGGGGAAGAGGGGGAGGGA
Full Trace Sequence: GGCCAGGGAACAGCTTATGACCATGTTAATACGACTCACTACTAGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAATTCATCGGATCGAATGACATGAAAGAGGGTGACATTGTAGAGAATTTGGTGCCCGTTGTTCCAAGCATACAAGGCCCTGTCCTTGGGGTTGTAGTCCAACATGGAGATGTGTGAGTAGAGGTTGTGGAAAGGAATGTCAATATATTCATAGTTGGATGTGTTGGTTTGATAAGCATAGTGTACTTTGGTGCCACCTGAATAACCATTGGTGACATAGAGAGTCCCACAAATCATAAAGGCCTCACCAGCACTCCTCTTAGGATAACCTGTGTTCCATGTTTTGAGGATTTGCAGTGTATTAGGATCCAGCTTGCTGATGACTATGTTACCAGCATTTTGATTTGTGGCATAAACAACCCACAATCCATTTTCATCCACCATGAGGTCAATGTCCGACTGTCCTCCCCAAGCATAGTGATAAACGTTGGTGTAGCCAGCCGAATCCAAGCTACGGGTCTTCAGTATTGTCTCTGATTTCAAGTCAAACCTGATGATGATGTGGCTTTGGAATTTGTTGAAATATATGGAACCATTGTAGACCACCTGCCCGGTCCCAGACCATGGATGCGGGAGGCGGTGAGAGGTAAAGTTGTCGGTATTCCTGAAATCTTGCATGGATTTGGAATCCCGAACAAATCTATTGTTTGTGGAACCATCCATACTACCAAATCTGTTTGCTCCGTCGGGAACGAGAGGAGCAGCATCCCGCAACCAAAACTGCAACCCGAAGTCTTTTATGGGAAGGGGTTGGCTAGTCCTGTGAGACTGCCGGAGGCCTATTATTGCATAATGCCACGAAGCCGTCCTTGAAATTTTAACCGCGGCTCCGCAGTGGCTCGGAACATAGGGCCCAGTCGCGGCGGTTAAGTTGTTTTAAGTAAACGTCAAATTCGGGATTCCGCGCTGGAGGTCGGAAACAAATTGGGGGCGAGCTTTGTGCGCTTACGGCCCGTGGAAAGGAAGAGGGGGGCGGGCGCAGGTGTGCCCTTTTATGGCCTTAGAACGGCCAGGGGGGGGGGGGTGGGGCGGGGTGGGGGGGGTGGCGGTGTGGTGTGGAGGATGCAATAACACAGGGGGCGCTAGAGAAGGAGGTGGTGGCGGGGTTGTTGCTGGGGGAGGAGTGAGGGTTGCAGCCCCGCGTCTGCGAGACGGCGGCCGGGAGGGGGCGCGGAGTGGGGTGGGGGTGGGGAAGAGGGGGAGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAATTCATCGGATCGAATGAC