ORFeome > ophn1 ORF1 – XORFeome v1.0

ophn1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ophn1
Gene ID: 6078676
Gene Page ID: 1009724
ORF Xenbase ID: 17287491

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059290
Original XGC clone length: 2376

Human orthology & disease relationships

NCBI Entrez ID: 4983
Ensembl gene IDs: ENSG00000079482
Directly associated (OMIM) disease MIM numbers: 300486
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ824565
dbEST ID: 79642267
Trimmed Sequence: ATGGGTCACCCGCCTCTGGAGTTCAGCGAATGTTACCTGGATAGCCCAGTCTTCCGAGAGAGCCTAAAGGGTTACGAGCAAGAGCTGGAGAGGACCAATAAGTTTATCAAAGATGTTATAAAAGATGGGAATGCTTTGATCAGTGCTATAAAAGGTTACTCCGGTGCAGTACAGAAATTCTCCCAAACCTTGCAAAGTTTCCAGTTTGACTTCATTGGGGACACCATGACAGATGATGAAATAAATATTGCTGAGTCCTTTAAAGAGTTTGCTGACCTACTGCAGGAAGTGGAGACTGAGAGGATGATGATGCTGCAAAATGCTGATGATCTACTTATCAAACCTCTTGAGAATTTCCGCAAGGATCAAATTGGACTCACAAAGGAGCGTAAGAAGAAGTTCGACAAGGACAGTGAGAAGTTTTATTCACTTCTGGATCGACATGTCAATTTATCATCTAAGAAGAAAGAGGTCCAGCTTAATGAGGCTGACCAGCAAGTGGACCGAGAGAAGCAGAATTTCTATGAATCCTCCCTAGAATATGTTTACCAGATTCAGGAAGTACAGGAAAGCAAGAAATTCTGCGTTGTAGAACCAGTACTGACGTTCCTACACTGTCTCTTCACTTCCAACAATCTCACCTTTGAACTGAGTCAGGATTTTCTTCCCTACAAACAGCAGTTGCAACTCAGCCTTCAGAATACTCGAAATCATTTCAGCAGCACCCGTGAAGAACTGGAGGATCCTGAGAAGCGAATGACTGAGGCGCCCATGGTGTGCAAGCTAAGGGGAACAAAGCCTATTCAAGGGATACTTGGTACTTCCCAA
Full Trace Sequence: ACAATAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTCACCCGCCTCTGGAGTTCAGCGAATGTTACCTGGATAGCCCAGTCTTCCGAGAGAGCCTAAAGGGTTACGAGCAAGAGCTGGAGAGGACCAATAAGTTTATCAAAGATGTTATAAAAGATGGGAATGCTTTGATCAGTGCTATAAAAGGTTACTCCGGTGCAGTACAGAAATTCTCCCAAACCTTGCAAAGTTTCCAGTTTGACTTCATTGGGGACACCATGACAGATGATGAAATAAATATTGCTGAGTCCTTTAAAGAGTTTGCTGACCTACTGCAGGAAGTGGAGACTGAGAGGATGATGATGCTGCAAAATGCTGATGATCTACTTATCAAACCTCTTGAGAATTTCCGCAAGGATCAAATTGGACTCACAAAGGAGCGTAAGAAGAAGTTCGACAAGGACAGTGAGAAGTTTTATTCACTTCTGGATCGACATGTCAATTTATCATCTAAGAAGAAAGAGGTCCAGCTTAATGAGGCTGACCAGCAAGTGGACCGAGAGAAGCAGAATTTCTATGAATCCTCCCTAGAATATGTTTACCAGATTCAGGAAGTACAGGAAAGCAAGAAATTCTGCGTTGTAGAACCAGTACTGACGTTCCTACACTGTCTCTTCACTTCCAACAATCTCACCTTTGAACTGAGTCAGGATTTTCTTCCCTACAAACAGCAGTTGCAACTCAGCCTTCAGAATACTCGAAATCATTTCAGCAGCACCCGTGAAGAACTGGAGGATCCTGAGAAGCGAATGACTGAGGCGCCCATGGTGTGCAAGCTAAGGGGAACAAAGCCTATTCAAGGGATACTTGGTACTTCCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTCACCCGCCTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829916
dbEST ID: 79647618
Trimmed Sequence: ACTTTCTTCTGTGAGGATACGGCTTGGAGGGGATGGTGGGCTTACTCTGGGTCTTGAGGCATTCTCAAAGAATTTTGTGCGGGAGGCCACCACAGAAGGGATATCCTCCTTCACTAGCGATGAAACTTCCGTCCTTGGCTCTTGTTTCTGTAGTGCTATCCTACATGGAGGATCTGGAGGTCTGTTTGGTGGACGGGAAATCACAGGCCTTTCTCCAGGGCTTCGTACTTTATTAATATTATCTCCTTCACCTTCTCTGGGAACTGCTGGACGGATTGGACCTCTTTTAGGGTGAAGCGGGGAAGGTTTGTTCGGTGCTGAGTATACAGGCAGATCCCCATTTAATTGCTTAGGGTTGGGCTTTCCATTTCCATCTTGCATCCTGGAGACCATCTTGGCCACATCTACATCAGAACTAGAATCTGACTGACCCTGAGTATCCAACATCTGTAGATTGGGATGGAGCTTTTTCCTCTGCAGGGGAAGGGGGTATTCATGGTTGTTTGTGACAGAACCATTCAATGTATGTCCTGGAAGCTCATCTTCTTCTTCGCTCTGACCAAGGTGTAGTCCACCTCTTCCTCTAGTCTGTCGCTTAGAGATGGTTATAAGGTATGTGGGTTTCTTGGTGTAATTCTGGGGAGGTGGTTACAGGGGGGCCCGCTGTTTATCATCAAGGGGGCCCAGGAGAATATTCTTCCTTTGCATTTTTTCAAT
Full Trace Sequence: TGACAGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTTTCTTCTGTGAGGATACGGCTTGGAGGGGATGGTGGGCTTACTCTGGGTCTTGAGGCATTCTCAAAGAATTTTGTGCGGGAGGCCACCACAGAAGGGATATCCTCCTTCACTAGCGATGAAACTTCCGTCCTTGGCTCTTGTTTCTGTAGTGCTATCCTACATGGAGGATCTGGAGGTCTGTTTGGTGGACGGGAAATCACAGGCCTTTCTCCAGGGCTTCGTACTTTATTAATATTATCTCCTTCACCTTCTCTGGGAACTGCTGGACGGATTGGACCTCTTTTAGGGTGAAGCGGGGAAGGTTTGTTCGGTGCTGAGTATACAGGCAGATCCCCATTTAATTGCTTAGGGTTGGGCTTTCCATTTCCATCTTGCATCCTGGAGACCATCTTGGCCACATCTACATCAGAACTAGAATCTGACTGACCCTGAGTATCCAACATCTGTAGATTGGGATGGAGCTTTTTCCTCTGCAGGGGAAGGGGGTATTCATGGTTGTTTGTGACAGAACCATTCAATGTATGTCCTGGAAGCTCATCTTCTTCTTCGCTCTGACCAAGGTGTAGTCCACCTCTTCCTCTAGTCTGTCGCTTAGAGATGGTTATAAGGTATGTGGGTTTCTTGGTGTAATTCTGGGGAGGTGGTTACAGGGGGGCCCGCTGTTTATCATCAAGGGGGCCCAGGAGAATATTCTTCCTTTGCATTTTTTCAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTTTCTTCTGTGAGGATACGG