ORFeome > orc3 ORF1 – XORFeome v1.0

orc3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: orc3
Gene ID: 984204
Gene Page ID: 984199
ORF Xenbase ID: 17287539

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041312
Original XGC clone length: 2130

Human orthology & disease relationships

NCBI Entrez ID: 23595
Ensembl gene IDs: ENSG00000135336
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 194050,216400,223100,259500,277700

Library Location

Plate ID: GDExl11009
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ823760
dbEST ID: 79641462
Trimmed Sequence: ATGACTACGTCATCTGTTTCCAAGGGATGTTTTGTGTTCAAACCAAGTGCCAAGAAGAAAAAGACTTCATTGACAGTAGCTGACTATTTTAATGAAGGTCTTAGAGATTCTGAAGATAGCAAAAAGCGGTTTGAGAGCTGTCAGTTACTATGGCAACAGATGAAATCACAGACAGAGCAACTTCAAGAGGAAATGAACAAAAGGCTTTTTGAGAACCTGATAGGCTTTTTAAGAAAATCTCATGCCGATTTTCACAATAAGAAAGACGATTGGAGCTGCAGGATGAGAGCGAGCGAGATTCCAACAGCCGCACTTGTTCTCGGAGTAAATGTTACAGACCATGATCTTACATTTAATAGTTTATCAGACATTCTTCATGAAACTATCACACCTTTCGTAGTGCTTCTGCAATCCAAGGAATGCACAGGGATTAAGCAACTACTTCAGAAACTCCTAACACAGCTTATGGGAAACACTGTAGATATTGATCTTGAGGAAGAAGAAGAGCAAGTGACCATATCACAGAGGAAAATGAACTGCACTTTGGCCTCCTTGTCTGGCTGGTATAAAAGGGCCACTAAGAAATCTGCCTCTCCAAAGAAGAAGAGGTCATTAACCTCTACTCATTGGGAGTCACCTCCTGTTGTTGTTATTTTTAAAGACTTGGAGAGTTTCACAGCCAGTGTTCTANCAGAATTTATTGTCATTAGTAGTGGTTATGTACAGGAT
Full Trace Sequence: CCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTACGTCATCTGTTTCCAAGGGATGTTTTGTGTTCAAACCAAGTGCCAAGAAGAAAAAGACTTCATTGACAGTAGCTGACTATTTTAATGAAGGTCTTAGAGATTCTGAAGATAGCAAAAAGCGGTTTGAGAGCTGTCAGTTACTATGGCAACAGATGAAATCACAGACAGAGCAACTTCAAGAGGAAATGAACAAAAGGCTTTTTGAGAACCTGATAGGCTTTTTAAGAAAATCTCATGCCGATTTTCACAATAAGAAAGACGATTGGAGCTGCAGGATGAGAGCGAGCGAGATTCCAACAGCCGCACTTGTTCTCGGAGTAAATGTTACAGACCATGATCTTACATTTAATAGTTTATCAGACATTCTTCATGAAACTATCACACCTTTCGTAGTGCTTCTGCAATCCAAGGAATGCACAGGGATTAAGCAACTACTTCAGAAACTCCTAACACAGCTTATGGGAAACACTGTAGATATTGATCTTGAGGAAGAAGAAGAGCAAGTGACCATATCACAGAGGAAAATGAACTGCACTTTGGCCTCCTTGTCTGGCTGGTATAAAAGGGCCACTAAGAAATCTGCCTCTCCAAAGAAGAAGAGGTCATTAACCTCTACTCATTGGGAGTCACCTCCTGTTGTTGTTATTTTTAAAGACTTGGAGAGTTTCACAGCCAGTGTTCTANCAGAATTTATTGTCATTAGTAGTGGTTATGTACAGGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTACGTCATCTGTTTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829069
dbEST ID: 79646771
Trimmed Sequence: GCATCCGCCCCATGTCAGCCGGGCCACATGATCAGTTTTCTGTTTGGTCGGCTTAACAAAGCCCAGGAGTTCCAGTTCTGAAACAGCTCTAATGAAGCGAGCATGGGTGACATCATCAACCTGTTGAGCTGAATCTGATTCGCTTCCCTCGGCCGCATGGACCACAGTTGCAAAAGCCTCTAGCCAATCATAAAGGTTTATCAGTCGGCCACACTCAAGGTGTAACTTGTAGGCAATGCAGATATCTGGTGCTGCATTGGAAATGGACCCACCCTCATTTTCCAAGCACTTCAGGTAAGAGGCTGGGTTGTTCAGAGCAGTGTGCAGAGCAACACGTGGGGCTGCATTAAGATGTCTGCGGAGGGTGCTGGCAGCACTAAAATATACAACTTCATGCAAGGGCAGCATTTCTGGGGGCAGAAGATATTCCCTCACTAGACCATCTATAAAGTCAACCACATCTTGTCGGAGCAACTCAAACCTTGAAGGTTTCTTAGTTCTTCTTGTTTCTTTCATTTCTAATAGTTTCTTCTGAAGCTGATACAGGTCTGTCTTCTTTTGCAGGCTTTTNGTGTGGGGAAGTGTCTTCATCCTCCCTCATTTTGTGTGGTTTCTTTCAGACTCTGGAAAATTGATCAGGAAATTCCTCTAGCTTCTCTAACGCCACTGNCCAAGTTTCTTTTTCCGAATAAGGTTTTCAAGAAAGCCCCACCA
Full Trace Sequence: GGGGGCGGCAGGAAACGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCATCCGCCCCATGTCAGCCGGGCCACATGATCAGTTTTCTGTTTGGTCGGCTTAACAAAGCCCAGGAGTTCCAGTTCTGAAACAGCTCTAATGAAGCGAGCATGGGTGACATCATCAACCTGTTGAGCTGAATCTGATTCGCTTCCCTCGGCCGCATGGACCACAGTTGCAAAAGCCTCTAGCCAATCATAAAGGTTTATCAGTCGGCCACACTCAAGGTGTAACTTGTAGGCAATGCAGATATCTGGTGCTGCATTGGAAATGGACCCACCCTCATTTTCCAAGCACTTCAGGTAAGAGGCTGGGTTGTTCAGAGCAGTGTGCAGAGCAACACGTGGGGCTGCATTAAGATGTCTGCGGAGGGTGCTGGCAGCACTAAAATATACAACTTCATGCAAGGGCAGCATTTCTGGGGGCAGAAGATATTCCCTCACTAGACCATCTATAAAGTCAACCACATCTTGTCGGAGCAACTCAAACCTTGAAGGTTTCTTAGTTCTTCTTGTTTCTTTCATTTCTAATAGTTTCTTCTGAAGCTGATACAGGTCTGTCTTCTTTTGCAGGCTTTTNGTGTGGGGAAGTGTCTTCATCCTCCCTCATTTTGTGTGGTTTCTTTCAGACTCTGGAAAATTGATCAGGAAATTCCTCTAGCTTCTCTAACGCCACTGNCCAAGTTTCTTTTTCCGAATAAGGTTTTCAAGAAAGCCCCACCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCATCCGCCCCATGTCAG