ORFeome > osgep ORF1 – XORFeome v1.0

osgep ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: osgep
Gene ID: 942951
Gene Page ID: 942944
ORF Xenbase ID: 17287587

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054300
Original XGC clone length: 1008

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ839586
dbEST ID: 79657288
Trimmed Sequence: ATGACCATTGTTGTTGGGTTCGAGGGGAGTGCCAACAAGATTGGTGTAGGAATAATCCAAGATGGGAAAGTGCTGAGCAATCCACGAAGAACCTACATCACTCCTCCAGGACAGGGCTTCATGCCAAGTGACACTGCACGTCACCATCGTTCCTGTATCCTAGATGTGCTGCAAGAAGCGCTCGAGGAATCAAATATAAAGCCGGAAGATGTAGATTGTGTAGCTTATACCAAAGGCCCTGGAATGGGAGCCCCTCTGCTGTCAGTAGCTATAGTGGCTCGGACAGTCGCACAGCTTTGGAAGAAGCCCCTATTGGGTGTTAATCACTGTATTGGGCATATTGAAATGGGAAGGCTGATAACTGGTGCAGAAAATCCCACTGTGCTGTATGTGAGCGGGGGCAACACACAGGTAATTGCATATTCAGAGCGCTGCTATCGAATATTTGGGGAAACAATAGATATTGCTGTGGGAAACTGTTTGGATCGATTTGCCAGAGTGCTAAAGATATCCAATGACCCCAGTCCTGGTTATAATATTGAACAGATGGCAAAGAAAGGCAAGAAGTTTGTGGAATTGCCATATACAGTTAAAGGAATGGATGTGTCATTCTCTGGAATTCTGTCTTACATCGAAGACATGTCTCATAAGATGCTGTCATCCTGGAAAAGGTACCCCTGAAGATCTCTGCTTCTCTCCTCCGGAAACCCTCTTCTCTATGCCTGGTGAAAAATTACAAACCGGGCAATGGCCCCTTTGGGGGTCTCAAGAAATTTCTTGAATTTGGGAAAGGCTTTTGGCTTTTAAGTGTAATTTTTACAAAAAAAT
Full Trace Sequence: GGTGGGCACAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCATTGTTGTTGGGTTCGAGGGGAGTGCCAACAAGATTGGTGTAGGAATAATCCAAGATGGGAAAGTGCTGAGCAATCCACGAAGAACCTACATCACTCCTCCAGGACAGGGCTTCATGCCAAGTGACACTGCACGTCACCATCGTTCCTGTATCCTAGATGTGCTGCAAGAAGCGCTCGAGGAATCAAATATAAAGCCGGAAGATGTAGATTGTGTAGCTTATACCAAAGGCCCTGGAATGGGAGCCCCTCTGCTGTCAGTAGCTATAGTGGCTCGGACAGTCGCACAGCTTTGGAAGAAGCCCCTATTGGGTGTTAATCACTGTATTGGGCATATTGAAATGGGAAGGCTGATAACTGGTGCAGAAAATCCCACTGTGCTGTATGTGAGCGGGGGCAACACACAGGTAATTGCATATTCAGAGCGCTGCTATCGAATATTTGGGGAAACAATAGATATTGCTGTGGGAAACTGTTTGGATCGATTTGCCAGAGTGCTAAAGATATCCAATGACCCCAGTCCTGGTTATAATATTGAACAGATGGCAAAGAAAGGCAAGAAGTTTGTGGAATTGCCATATACAGTTAAAGGAATGGATGTGTCATTCTCTGGAATTCTGTCTTACATCGAAGACATGTCTCATAAGATGCTGTCATCCTGGAAAAGGTACCCCTGAAGATCTCTGCTTCTCTCCTCCGGAAACCCTCTTCTCTATGCCTGGTGAAAAATTACAAACCGGGCAATGGCCCCTTTGGGGGTCTCAAGAAATTTCTTGAATTTGGGAAAGGCTTTTGGCTTTTAAGTGTAATTTTTACAAAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCATTGTTGTTGGGTTCGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839585
dbEST ID: 79657287
Trimmed Sequence: ATCTCTCCATGTCACTTCCACCTCATCAGTGCGGTACCTTTGGGTTATCCATGAATCCTGCAGATTGGTTACTTGTCCAGCGCGGAACATCTCCCATCCAGCCTGTGCAATCATAGCTCCATTATCTATGCAGAATCTTTCATCTGTTGCAAAAATCTTAGCTCCACGTTCCTCACACATCACTCCCATCATTTCTTGTAAACGTACATTACAGCCAACGCCTCCCACTATCAGAACTTCTTGTGACCCACAATGTGCCATTGCCCGCTCTGTAATTTCCACCAGCATAGAGAAGAGGGTCTCCTGTAGAGAGAAGCAGAGATCCTCAGGGGTACATTCTCCAGATGACAGCATCTTATGAGACATGTCCTCGATGTAAGACAGAATTCCAGAGAATGACACATCCATTCCTTTAACTGTATATGGCAATTCCACAAACTTCTTGCCTTTCTTTGCCATCTGTTCAATATTATAACCAGGACTGGGGTCATTGGATATCTTTAGCACTCTGGCAAATCGATCCAAACAGTTTCCCACAGCAATATCTATTGTTTCCGAAAATATTCGATAGCAGCGCTCTGAATAATGCATTACCTGTGTGTTGCCCCCGCTCCAAACCGCAAAGAGGGGATTTTCTGCACCAGTTATCAGCCTTCCATTTTCAATAGCCCAAAAACGTGGATTAAAACCCCAAAAGGGGCTTCCTTCAAAAACTGTTCCAAACTGTTCCAAACCCCATAAATCCCTCCTTGAACGACCAAAG
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCTCTCCATGTCACTTCCACCTCATCAGTGCGGTACCTTTGGGTTATCCATGAATCCTGCAGATTGGTTACTTGTCCAGCGCGGAACATCTCCCATCCAGCCTGTGCAATCATAGCTCCATTATCTATGCAGAATCTTTCATCTGTTGCAAAAATCTTAGCTCCACGTTCCTCACACATCACTCCCATCATTTCTTGTAAACGTACATTACAGCCAACGCCTCCCACTATCAGAACTTCTTGTGACCCACAATGTGCCATTGCCCGCTCTGTAATTTCCACCAGCATAGAGAAGAGGGTCTCCTGTAGAGAGAAGCAGAGATCCTCAGGGGTACATTCTCCAGATGACAGCATCTTATGAGACATGTCCTCGATGTAAGACAGAATTCCAGAGAATGACACATCCATTCCTTTAACTGTATATGGCAATTCCACAAACTTCTTGCCTTTCTTTGCCATCTGTTCAATATTATAACCAGGACTGGGGTCATTGGATATCTTTAGCACTCTGGCAAATCGATCCAAACAGTTTCCCACAGCAATATCTATTGTTTCCGAAAATATTCGATAGCAGCGCTCTGAATAATGCATTACCTGTGTGTTGCCCCCGCTCCAAACCGCAAAGAGGGGATTTTCTGCACCAGTTATCAGCCTTCCATTTTCAATAGCCCAAAAACGTGGATTAAAACCCCAAAAGGGGCTTCCTTCAAAAACTGTTCCAAACTGTTCCAAACCCCATAAATCCCTCCTTGAACGACCAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTCTCCATGTCACTTCCACCT