ORFeome > osr2 ORF2 – XORFeome v1.0

osr2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: osr2
Gene ID: 864802
Gene Page ID: 481906
ORF Xenbase ID: 17287605

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123222
Original XGC clone length: 816

Human orthology & disease relationships

NCBI Entrez ID: 116039
Ensembl gene IDs: ENSG00000164920
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 252010

Library Location

Plate ID: GDExl11088
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ838210
dbEST ID: 79655912
Trimmed Sequence: ATGGGCAGCAAAGCTCTTCCAGCCCCCATCCCTTTACACCCATCTCTGCAGCTCACCAACTACTCCTTCCTCCAGGCGGTGAACACCTTCCCGGCAGCAGTTGACCATCTGCAAGGACTTTATGGACTGAGCGCTGTACAGACCATGCATATGAACCATTGGACTCTGGGATACCCCAACTTGCATGGCATCACAAGGTCCACCATCACAGAGATGGCAGCGGCCCAAGGCTTAATGGATGCCAGGTTTTCTTTCCCAGCTTTACCCTTTGCCACCCATCTTTTTCACCCCAAACAAGGAACCATCGCCCATGTTATACCAGCCTTGCACAAGGACAGGCCCCGCTTTGACTTTGCCAATTTAGCCATTGCTGCCACCCAGGAGGACCCACCTAAAATAGGTGACTTGTCCAAGCTGAGCCCTGGGCTTGGGAGCCCTATCTCAGAGATTAGCAAGCTATCCCCTGACCGAAAACCTTCCAGGGGGAGGCTGCCCTCCAAGACAAAAAAAGAGTTTATCTGCAAGTTCTGCGGAAGGCATTTTACCAAATCCTACAACCTGCTCATCCACGAGAGAACACACACAGACGAGCGGCCATACACGTGTGACATATGCCACAAAGCTTTCCAAAAACAGGAACACCCTGAAAAACCACAAAATCATTCATTCCAAAAAAAAACATTCCAATGTCCGGAGTGGTGGCAAGGAATCTGTCATTCCAAAAACCCTACCGTGGCAATAAACTTAAAAATTGCAAAAATCAAGCCCCCAACCTTTTGGAACAAATGGCGGAAAAAATTTTTCCGGGAAAAAAAAGTGGAA
Full Trace Sequence: CTCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCAGCAAAGCTCTTCCAGCCCCCATCCCTTTACACCCATCTCTGCAGCTCACCAACTACTCCTTCCTCCAGGCGGTGAACACCTTCCCGGCAGCAGTTGACCATCTGCAAGGACTTTATGGACTGAGCGCTGTACAGACCATGCATATGAACCATTGGACTCTGGGATACCCCAACTTGCATGGCATCACAAGGTCCACCATCACAGAGATGGCAGCGGCCCAAGGCTTAATGGATGCCAGGTTTTCTTTCCCAGCTTTACCCTTTGCCACCCATCTTTTTCACCCCAAACAAGGAACCATCGCCCATGTTATACCAGCCTTGCACAAGGACAGGCCCCGCTTTGACTTTGCCAATTTAGCCATTGCTGCCACCCAGGAGGACCCACCTAAAATAGGTGACTTGTCCAAGCTGAGCCCTGGGCTTGGGAGCCCTATCTCAGAGATTAGCAAGCTATCCCCTGACCGAAAACCTTCCAGGGGGAGGCTGCCCTCCAAGACAAAAAAAGAGTTTATCTGCAAGTTCTGCGGAAGGCATTTTACCAAATCCTACAACCTGCTCATCCACGAGAGAACACACACAGACGAGCGGCCATACACGTGTGACATATGCCACAAAGCTTTCCAAAAACAGGAACACCCTGAAAAACCACAAAATCATTCATTCCAAAAAAAAACATTCCAATGTCCGGAGTGGTGGCAAGGAATCTGTCATTCCAAAAACCCTACCGTGGCAATAAACTTAAAAATTGCAAAAATCAAGCCCCCAACCTTTTGGAACAAATGGCGGAAAAAATTTTTCCGGGAAAAAAAAGTGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCAGCAAAGCTCTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838209
dbEST ID: 79655911
Trimmed Sequence: AATCGCAATTTCTCCGGAAAACTTTTCCGCACTGCTCACAACTGTAGGGCTTGATGTCTGCATGTGTAAGGTTTTATGCACGGCCAGAGTTCTGGACTGACAGAATCCTTTGCCACACTCCTGACATTTGAATGGTTTCTCTTTGGAATGAATGTATCTGTGGTCTCTCAGGTGGTCCTGTCTTCTGAAAGCTTTGTGGCATATGTCACACGTGTATGGCCGCTCGTCTGTGTGTGTTCTCTCGTGGATGAGCAGGTTGTAGGATTTGGTAAAATGCCTTCCGCAGAACTTGCAGATAAACTCTTTTTTTGTCTTGGAGGGCAGCCTCCCCCTGGAAGGTTTTCGGTCAGGGGATAGCTTGCTAATCTCTGAGATAGGGCTCCCAAGCCCAGGGCTCAGCTTGGACAAGTCACCTATTTTAGGTGGGTCCTCCTGGGTGGCAGCAATGGCTAAATTGGCAAAGTCAAAGCGGGGCCTGTCCTTGTGCAAGGCTGGTATAACATGGGCGATGGTTCCTTGTTTGGGGTGAAGGAGATGGGTGGCAGAGGGTAAAGCTGGGAAAGAAAACCTGGCATCCATTTAGCCCTGGGCCCCTGCCCTCTCCGTGAATGTGGACCTTGTTGATGCATGGCAGTTTGGGGTATCCCGGAGGTCCCATGGTTTCAAATTCCATGGTCTGGTACGGCGGCTCAGTCCAATAAGGCCCCTTCCAAATGGTTCAACTGCTTGCCCCGATAAAGGGATTCCCCCCCCCTGGGGGGAGAAGAAAAGTAGTGTT
Full Trace Sequence: GGGAAAAGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATCGCAATTTCTCCGGAAAACTTTTCCGCACTGCTCACAACTGTAGGGCTTGATGTCTGCATGTGTAAGGTTTTATGCACGGCCAGAGTTCTGGACTGACAGAATCCTTTGCCACACTCCTGACATTTGAATGGTTTCTCTTTGGAATGAATGTATCTGTGGTCTCTCAGGTGGTCCTGTCTTCTGAAAGCTTTGTGGCATATGTCACACGTGTATGGCCGCTCGTCTGTGTGTGTTCTCTCGTGGATGAGCAGGTTGTAGGATTTGGTAAAATGCCTTCCGCAGAACTTGCAGATAAACTCTTTTTTTGTCTTGGAGGGCAGCCTCCCCCTGGAAGGTTTTCGGTCAGGGGATAGCTTGCTAATCTCTGAGATAGGGCTCCCAAGCCCAGGGCTCAGCTTGGACAAGTCACCTATTTTAGGTGGGTCCTCCTGGGTGGCAGCAATGGCTAAATTGGCAAAGTCAAAGCGGGGCCTGTCCTTGTGCAAGGCTGGTATAACATGGGCGATGGTTCCTTGTTTGGGGTGAAGGAGATGGGTGGCAGAGGGTAAAGCTGGGAAAGAAAACCTGGCATCCATTTAGCCCTGGGCCCCTGCCCTCTCCGTGAATGTGGACCTTGTTGATGCATGGCAGTTTGGGGTATCCCGGAGGTCCCATGGTTTCAAATTCCATGGTCTGGTACGGCGGCTCAGTCCAATAAGGCCCCTTCCAAATGGTTCAACTGCTTGCCCCGATAAAGGGATTCCCCCCCCCTGGGGGGAGAAGAAAAGTAGTGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATCGCAATTTCTCCGGAAAACT