ORFeome > otos ORF1 – XORFeome v1.0

otos ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: otos
Gene ID: 6254557
Gene Page ID: 971578
ORF Xenbase ID: 17287647

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078483
Original XGC clone length: 270

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ839712
dbEST ID: 79657414
Trimmed Sequence: ATGAAGCTGCTTCTTATTGGATTATATTTCTCTTGTGTTTTACTTGGCACGTTCATTGATGCCAGACCAGTGTATGAAGAGGAAGATCCATACTTGGACGCCCCTGCTCATCCTTACTGGCCCTTCTCCACTTCAGATTTCTGGCTGTATGTGGAGCATTTCCGCTCCCTGGGCGCATACGACAAGATAAATGATATGGCTCGTACCTTCTTTGCTCACTACCCTATTGGGGATACTCTTGGATACACTAGCAAAAACCATGATGAATT
Full Trace Sequence: GCGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGCTGCTTCTTATTGGATTATATTTCTCTTGTGTTTTACTTGGCACGTTCATTGATGCCAGACCAGTGTATGAAGAGGAAGATCCATACTTGGACGCCCCTGCTCATCCTTACTGGCCCTTCTCCACTTCAGATTTCTGGCTGTATGTGGAGCATTTCCGCTCCCTGGGCGCATACGACAAGATAAATGATATGGCTCGTACCTTCTTTGCTCACTACCCTATTGGGGATACTCTTGGATACACTAGCAAAAACCATGATGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCAAAAGTCTCAAAATCTCTGATGTTACATGGCAGCACAGACTGGATAAAAAAACAAAAAAAGAATTACTAAATCCTCTCCGCTTTTCATTGTATATAAATGTTGTAAACTTCCCTACTCCACGCCCTTTACACAGCGCTGGATCGGTCAAGATTCTGCAACAACCCTCAAAGTCATCCCCCCACCAGGAACAAACAAATCATTGAACCATTGTTATAAAGGGACGTTTTGTGTTAGATCACCGCATCTCATTATTTTGTCCCCAAACATTCTTTACCCAACCTAAAAACTGGGAGAATACCCTGGGTTGAAGATTTTTTTTCCCGGTTAAATATAAATTAAACTTTTTCTGAAGGAAATACAAAAAAAAACCCCGCCCAAAGCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCTGCTTCTTATTGGATTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839711
dbEST ID: 79657413
Trimmed Sequence: TTCATCATGGTTTTTGCTAGTGTATCCAAGAGTATCCCCAATAGGGTAGTGAGCAAAGAAGGTACGAGCCATATCATTTATCTTGTCGTATGCGCCCAGGGAGCGGAAATGCTCCACATACAGCCAGAAATCTGAAGTGGAGAAGGGCCAGTAAGGATGAGCAGGGGCGTCCAAGTATGGATCTTCCTCTTCATACACTGGTCTGGCATCAATGAACGTGCCAAGTAAAACACAAGAGAAATATAATCCAATAAGAAGCAGCTTCATGG
Full Trace Sequence: AAAATGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCATCATGGTTTTTGCTAGTGTATCCAAGAGTATCCCCAATAGGGTAGTGAGCAAAGAAGGTACGAGCCATATCATTTATCTTGTCGTATGCGCCCAGGGAGCGGAAATGCTCCACATACAGCCAGAAATCTGAAGTGGAGAAGGGCCAGTAAGGATGAGCAGGGGCGTCCAAGTATGGATCTTCCTCTTCATACACTGGTCTGGCATCAATGAACGTGCCAAGTAAAACACAAGAGAAATATAATCCAATAAGAAGCAGCTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCGACCTTAATACTGGACGAAAAATTACAACGTCAATGACATGGCATAAACGTGACCGCACTGGAAAGGAAAAAAAAATCTTAAATAATGCAACACGGCGTTTCCTTTGGAGGTGTCTTGGGAGAAAACACTGGCTAAAAACAAAGAGACAAGGGCTGTGTTTTAAAAATTGTAAAAACGAAGCAAGAGTGCCAAAAAAAGGGAGAAACACATCTGAGGAAGAANGGTGGAAAACGGCGGGGGGGGGTTCTCGGTTGTGTTAGGATTTTTTTTGTNGTGAGAAATTAAANCCAGGGGCCCACCACCAACCAAGGGGGACACCGGGGGAGGTATTTGTTGATGGTCGNTGGGNNNAGGGNNTTGTTGTTTGGGGGGGGGANAANNC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCATCATGGTTTTTGCTAGTGTA