ORFeome > otud6b ORF1 – XORFeome v1.0

otud6b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: otud6b
Gene ID: 985124
Gene Page ID: 985118
ORF Xenbase ID: 17287683

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141761
Original XGC clone length: 933

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ838841
dbEST ID: 79656543
Trimmed Sequence: ATGGATGAGGTGGAAGAGAACTCGGAAGAGGGTCTGTTGATTAAGCAGCACCGTAAGGAGAAGAAGGACCTGCAAGCCAAAATACAGAGCATGAAGAATAATGTGCCCAAGAATGACAAAAAGAGAAGGAAGCAGCTGACTGAAGATATTGCTAAGTTGGAAGCAAAACTCGAAGCGAGACACTAAGGAGACTTGGAAGCCCTGTCACAGAAGCAAACTGGACCAACCCAAATGTGTCCCATTGTGCATCAGCTGTGTGAGGAGTGCTGTCTCTTTATGGTGAGCGGTATTACATATGGCGTGAAGACTTTATATTTGGAGGGTGAGGAGCTACTTCGGCAGCCACCCGTATCCAAGGCGGAGAATAAAAGCGCGAAATAGGCGGCCCGCAGAGTAATAAAGCGATGGGACGCATATGCTTGAGGGATATGTTTGTTGGTTTTTTTTATTGCTTGTGTTGCGGTGTAGGGCTTCAAACAGGGTCTCGCGTCTTTGTTTTAGGACGGCGCTGGCAGATCAAGTAGGGGCGCCTCCCACGTGTGGGGCGCCTCGCGGGGCGGCCCATTGACTGTAGAAGCTGTCTGTACCCGGCGGGAGGGGGGGTCGGCTTTCGCCTGGGTTTTTTAANCGGAGAGCGGGCTTTCTTGTGTAATATGTGGGCATGCATGTCGAAGGGAACAGTGGTTGTGCCTGTCGTGTGTGGTGGGGGCGTCGTTGCCTCACTTTTTTGTCGGTAGTGATCACAAGACGACCATTATAGGATTTGTGGATAGAGGATCGGTGGATAGTGAAGAGAGTGATAAAGCTCAAGTTGGGCGTGTGGGGGTGGGGGGGGGCAATGTGATGTGAGGGAAAGTGGG
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGAGGTGGAAGAGAACTCGGAAGAGGGTCTGTTGATTAAGCAGCACCGTAAGGAGAAGAAGGACCTGCAAGCCAAAATACAGAGCATGAAGAATAATGTGCCCAAGAATGACAAAAAGAGAAGGAAGCAGCTGACTGAAGATATTGCTAAGTTGGAAGCAAAACTCGAAGCGAGACACTAAGGAGACTTGGAAGCCCTGTCACAGAAGCAAACTGGACCAACCCAAATGTGTCCCATTGTGCATCAGCTGTGTGAGGAGTGCTGTCTCTTTATGGTGAGCGGTATTACATATGGCGTGAAGACTTTATATTTGGAGGGTGAGGAGCTACTTCGGCAGCCACCCGTATCCAAGGCGGAGAATAAAAGCGCGAAATAGGCGGCCCGCAGAGTAATAAAGCGATGGGACGCATATGCTTGAGGGATATGTTTGTTGGTTTTTTTTATTGCTTGTGTTGCGGTGTAGGGCTTCAAACAGGGTCTCGCGTCTTTGTTTTAGGACGGCGCTGGCAGATCAAGTAGGGGCGCCTCCCACGTGTGGGGCGCCTCGCGGGGCGGCCCATTGACTGTAGAAGCTGTCTGTACCCGGCGGGAGGGGGGGTCGGCTTTCGCCTGGGTTTTTTAANCGGAGAGCGGGCTTTCTTGTGTAATATGTGGGCATGCATGTCGAAGGGAACAGTGGTTGTGCCTGTCGTGTGTGGTGGGGGCGTCGTTGCCTCACTTTTTTGTCGGTAGTGATCACAAGACGACCATTATAGGATTTGTGGATAGAGGATCGGTGGATAGTGAAGAGAGTGATAAAGCTCAAGTTGGGCGTGTGGGGGTGGGGGGGGGCAATGTGATGTGAGGGAAAGTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGAGGTGGAAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838840
dbEST ID: 79656542
Trimmed Sequence: GCTGTTCTCTGTAATTGTGTCCAGATTTTCAACGGAATTGTAATGTTCCCCCAGTCCATACGCATGTCGCATATATACTAAGGTGATCGATTTGTTTGAGTATTCTTCACCAATGACAATAGGTGAGGATTCTGCCTGGATCACTTCTATAGGTGTTTTCAGAATATGAGACAGGGCTCTAAGCTCTAACTGGCCACCCCATGCTGGTGTATTCACTATGTCAGTGCAGTATTTCAGAAACTCTTCGTGTGTGTACATCCCGCCTGTTGAGGAGTTTGTTAAGAATGGAAGGAAATCTTCAGCATGATTTTGCATATAGTCTGCAGTTTGGCTTCTAAAATTTGCTACAGTGAAGGCATTACCTCGCTCGTTCAATTGGTGTTCAATATCTTTGTACATGCAGTGTCCATCAGAGGGGATCTGCCTGATCTGCAGCTCCCTCTCTAACAAAATGTGGGCAAGTTTCTGGCTTTCGATGTGCCTGGCTCCTGATAAATTGACTATTTCTGCCTCACCAATGCGTGCATCCCTTTCTTTTTTCTGTGCAGCCTTGTGTTCCCTTCCTCTTCTTGGCCTTGGATACGCAGGGGCTGCGGAGCGGCGTCCGCACGTTCCAAATCTAATCTGTTTCTGCCAATTGGTATAACACGCTCACATTAACGTGACAACACTCACGCCCCAACCTTCCTCCAAAAGGGGAAACAACATGGGGTGAGACCCAGTTTGGGTTTGCTGGAACAGGGGCTTTCTAAGGGTCGCAGGTGAGACCTCTTC
Full Trace Sequence: GGGAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGTTCTCTGTAATTGTGTCCAGATTTTCAACGGAATTGTAATGTTCCCCCAGTCCATACGCATGTCGCATATATACTAAGGTGATCGATTTGTTTGAGTATTCTTCACCAATGACAATAGGTGAGGATTCTGCCTGGATCACTTCTATAGGTGTTTTCAGAATATGAGACAGGGCTCTAAGCTCTAACTGGCCACCCCATGCTGGTGTATTCACTATGTCAGTGCAGTATTTCAGAAACTCTTCGTGTGTGTACATCCCGCCTGTTGAGGAGTTTGTTAAGAATGGAAGGAAATCTTCAGCATGATTTTGCATATAGTCTGCAGTTTGGCTTCTAAAATTTGCTACAGTGAAGGCATTACCTCGCTCGTTCAATTGGTGTTCAATATCTTTGTACATGCAGTGTCCATCAGAGGGGATCTGCCTGATCTGCAGCTCCCTCTCTAACAAAATGTGGGCAAGTTTCTGGCTTTCGATGTGCCTGGCTCCTGATAAATTGACTATTTCTGCCTCACCAATGCGTGCATCCCTTTCTTTTTTCTGTGCAGCCTTGTGTTCCCTTCCTCTTCTTGGCCTTGGATACGCAGGGGCTGCGGAGCGGCGTCCGCACGTTCCAAATCTAATCTGTTTCTGCCAATTGGTATAACACGCTCACATTAACGTGACAACACTCACGCCCCAACCTTCCTCCAAAAGGGGAAACAACATGGGGTGAGACCCAGTTTGGGTTTGCTGGAACAGGGGCTTTCTAAGGGTCGCAGGTGAGACCTCTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGTTCTCTGTAATTGTGTC