ORFeome > otx1 ORF1 – XORFeome v1.0

otx1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: otx1
Gene ID: 939807
Gene Page ID: 939803
ORF Xenbase ID: 17287689

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123255
Original XGC clone length: 1017

Human orthology & disease relationships

NCBI Entrez ID: 5013
Ensembl gene IDs: ENSG00000115507
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219100

Library Location

Plate ID: GDExl11091
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ838803
dbEST ID: 79656505
Trimmed Sequence: ATGATGTCCTACCTCAAACAGCCCCCCTATGGCATGAATGGCTTGGGGCTGACGGGACCTGCAATGGACTTGCTGCACCCATCAGTGGGCTACCCAGCCACTCCGCGGAAGCAGCGCAGAGAGCGCACCACGTTCACCCGCTCGCAGCTGGATGTGCTGGAGTCCCTGTTCGCCAAGACTCGTTACCCGGACATCTTCATGCGCGAAGAAGTGGCCCTAAAGATCAACCTGCCCGAGTCCAGAGTACAGGTCTGGTTCAAGAACAGACGAGCCAAGTGTCGGCAGCAGCAGCAGCAACAACAGCAGCAGAGCAGCAGCGGGGCCGGAGTGAAGAGCCGCCCGGCCAAGAAGAAGTGCAGCCCGGCCAGAGAGAGTTCTGGGTCGGAGAGCAGCGGTCAGTTCACTCCCCCCGCGGTGTCCAGCTCCGGCTCTTCCTCTTCGTCCTCTTCTTCCAGTTCCAATTCCACCGGGAACCCGGCGTTGACTTCAGCCCCACTGAATGGCAGCAGCTCCACCGCGTCCTCCATCTGGAGCCCAGCCTCCATCTCTCCTGGGCACCGCCCCTGGCTCTGGCCCCGACCCCCTGGGAACAGGCAGCGCCTCGTGCATGCACGGCTCTGGCTCCTCTTCTGCCCCCTCCATTCCATGTCCTACAATTAGGGCGGCCGGCTAACACCCAGCCCAACCCCCCCCCCTCCTCCAACTTCTATGGGGGTTCAAATTGTACCTCCTAACTTGGGCCCCCCTCGGTTCTCCCGCCATCACCTCCCTTCAATATCAACCCTTTATGACCCCCCTTCCTTTATATTTATCGTGGCA
Full Trace Sequence: CTCGTGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGTCCTACCTCAAACAGCCCCCCTATGGCATGAATGGCTTGGGGCTGACGGGACCTGCAATGGACTTGCTGCACCCATCAGTGGGCTACCCAGCCACTCCGCGGAAGCAGCGCAGAGAGCGCACCACGTTCACCCGCTCGCAGCTGGATGTGCTGGAGTCCCTGTTCGCCAAGACTCGTTACCCGGACATCTTCATGCGCGAAGAAGTGGCCCTAAAGATCAACCTGCCCGAGTCCAGAGTACAGGTCTGGTTCAAGAACAGACGAGCCAAGTGTCGGCAGCAGCAGCAGCAACAACAGCAGCAGAGCAGCAGCGGGGCCGGAGTGAAGAGCCGCCCGGCCAAGAAGAAGTGCAGCCCGGCCAGAGAGAGTTCTGGGTCGGAGAGCAGCGGTCAGTTCACTCCCCCCGCGGTGTCCAGCTCCGGCTCTTCCTCTTCGTCCTCTTCTTCCAGTTCCAATTCCACCGGGAACCCGGCGTTGACTTCAGCCCCACTGAATGGCAGCAGCTCCACCGCGTCCTCCATCTGGAGCCCAGCCTCCATCTCTCCTGGGCACCGCCCCTGGCTCTGGCCCCGACCCCCTGGGAACAGGCAGCGCCTCGTGCATGCACGGCTCTGGCTCCTCTTCTGCCCCCTCCATTCCATGTCCTACAATTAGGGCGGCCGGCTAACACCCAGCCCAACCCCCCCCCCTCCTCCAACTTCTATGGGGGTTCAAATTGTACCTCCTAACTTGGGCCCCCCTCGGTTCTCCCGCCATCACCTCCCTTCAATATCAACCCTTTATGACCCCCCTTCCTTTATATTTATCGTGGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGTCCTACCTCAAACAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838802
dbEST ID: 79656504
Trimmed Sequence: CAACACCTGGAACCTCCAGGAGGCCTGATCTTTGTAGTCCAGGCAGTCGGTGGAATTGAAGTTGAGTTTCCAAGAGGAGGCGGTGGCTTGCTCCTTATAGTCCAGACAGTCAGACGAGTTAAAGGGCAAGGCCGAGCTGGTGTAACCCTGGTGATGATGATGGTGGTGGTGATGGCTGGAGGTCTGGCTCAGGTGATGATGATGATGGTGGTGGCCAGACATAGAGGAAGGGGCCATATGGCTGAGCTGATGAGGGTGATGGTGGGAATGCATGGGGCCCAGGTAGGAGCTGCAATCTACCCCGCTGAAGTAAGAGGACGGGGCGGGGTAGGCCGGAGTGTAGCCGAGAGCCTGACTGTACCGACGGGTGAAGGATACGGCTGACGAAGACTCACAGTGCTCCCTGCACAAGATGTTCCCGTTTTCTACGGCATTAGTGGCTACAGCATAGAGGCCGATTCTTATCTATGAATGTCGATTCTACTTATTTCGAAACGCACTTGACTGCGGGCCATGGAATACTGCTCGAAACAACACGCAATAGCCTGGAGGAGCTGTCACTCAACGATAAGGAAAAATATCACATCAACAAGCGAAAGCGAAAGGAGGAAAAGGGAAGTGAAGGTAACCAAGGGGCCNGAATCCTGNTGCCCCCGAGGTGGGGGGTGAAGGAGGGGGCAATTCCGGGATTGACCGGGAAGACCCTCCTGGCGAACACCCCTCCAGGTGTGAATCTNTTNTATAGNAGGCTGTCCCCCCTTGCCCGCGCGCAACGANCGGG
Full Trace Sequence: AATAGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAACACCTGGAACCTCCAGGAGGCCTGATCTTTGTAGTCCAGGCAGTCGGTGGAATTGAAGTTGAGTTTCCAAGAGGAGGCGGTGGCTTGCTCCTTATAGTCCAGACAGTCAGACGAGTTAAAGGGCAAGGCCGAGCTGGTGTAACCCTGGTGATGATGATGGTGGTGGTGATGGCTGGAGGTCTGGCTCAGGTGATGATGATGATGGTGGTGGCCAGACATAGAGGAAGGGGCCATATGGCTGAGCTGATGAGGGTGATGGTGGGAATGCATGGGGCCCAGGTAGGAGCTGCAATCTACCCCGCTGAAGTAAGAGGACGGGGCGGGGTAGGCCGGAGTGTAGCCGAGAGCCTGACTGTACCGACGGGTGAAGGATACGGCTGACGAAGACTCACAGTGCTCCCTGCACAAGATGTTCCCGTTTTCTACGGCATTAGTGGCTACAGCATAGAGGCCGATTCTTATCTATGAATGTCGATTCTACTTATTTCGAAACGCACTTGACTGCGGGCCATGGAATACTGCTCGAAACAACACGCAATAGCCTGGAGGAGCTGTCACTCAACGATAAGGAAAAATATCACATCAACAAGCGAAAGCGAAAGGAGGAAAAGGGAAGTGAAGGTAACCAAGGGGCCNGAATCCTGNTGCCCCCGAGGTGGGGGGTGAAGGAGGGGGCAATTCCGGGATTGACCGGGAAGACCCTCCTGGCGAACACCCCTCCAGGTGTGAATCTNTTNTATAGNAGGCTGTCCCCCCTTGCCCGCGCGCAACGANCGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAACACCTGGAACCTCC