ORFeome > oxct1 ORF1 – XORFeome v1.0

oxct1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: oxct1
Gene ID: 976571
Gene Page ID: 976565
ORF Xenbase ID: 17287713

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059355
Original XGC clone length: 1593

Human orthology & disease relationships

NCBI Entrez ID: 5019
Ensembl gene IDs: ENSG00000083720
Directly associated (OMIM) disease MIM numbers: 245050
Indirectly associated (Lage, et al.) disease MIM numbers: 203750,231530,245050,250950,300438,312170,606054,609015,609975

Library Location

Plate ID: GDExl11020
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ824681
dbEST ID: 79642383
Trimmed Sequence: ATGGCTGCTGCTTGTAATCTCCTGGCCACGCTCAGAAGAGGTATCGCCTTGCAGGCCGGATGGCAACACAGGAGCAGGGTTAGCGCGGCCTGGATTGGGCAGAACAAGAGCTGCAGCTGCTATTTTTCCACCAGCAACCAGCGGCATTCCAAATTCTACTCCGACCCCGTGGAAGCAGTGAAAGACATCCCAGATGGTTCAACACTACTTGTTGGAGGCTTTGGTTTGTGTGGAATCCCAGAGAATCTTATCTCAGGACTCCTGAAGACTGGAGTTAAAGGGATCACAGCTGTGAGCAACAATGCAGGTGTGGATAACTTCGGCCTGGGCCTTTTGCTTAAGACCAAGCAAATAAAGCGAATGATCTCTTCGTATGTCGGGGAGAATGCAGAATTCGAGCGCCAGTATTTGGAAGGGGAACTGGAGGTAGAACTGGTACCACAGGGAACTCTGGCAGAGCGGGTACGAGCAGGAGGTGCTGGCATTCCCGCGTTTTTTACACCCACTGGCTACGGAACGTTAATACAAGAAGGCGGAGCTCCAATTAAATATAATAAAGATGGCACGATTGCTATAGCCAGCCAACCGAAGGAGGTGAAAGAATTCAGTGGGCGCCATTTTGTTATGGAAACTCAATCACAGGAGATTTTGCTTTAGTGAAAGCCTGGAAGGCAGATCTTGTGGAAAATATAGTGGTCAGGAAACAAGCAGAACTTCAACCAGCCCATGTGCAAACACCAAGTAACTGTGGTTTAGAGGGGGAGGGAAGATTGTTTAAAACGGGAAATTTGCCCCCCAAAGAAGTCCCCATTCCCCCCACCTACCTAAACCCG
Full Trace Sequence: AATTGATTTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGCTTGTAATCTCCTGGCCACGCTCAGAAGAGGTATCGCCTTGCAGGCCGGATGGCAACACAGGAGCAGGGTTAGCGCGGCCTGGATTGGGCAGAACAAGAGCTGCAGCTGCTATTTTTCCACCAGCAACCAGCGGCATTCCAAATTCTACTCCGACCCCGTGGAAGCAGTGAAAGACATCCCAGATGGTTCAACACTACTTGTTGGAGGCTTTGGTTTGTGTGGAATCCCAGAGAATCTTATCTCAGGACTCCTGAAGACTGGAGTTAAAGGGATCACAGCTGTGAGCAACAATGCAGGTGTGGATAACTTCGGCCTGGGCCTTTTGCTTAAGACCAAGCAAATAAAGCGAATGATCTCTTCGTATGTCGGGGAGAATGCAGAATTCGAGCGCCAGTATTTGGAAGGGGAACTGGAGGTAGAACTGGTACCACAGGGAACTCTGGCAGAGCGGGTACGAGCAGGAGGTGCTGGCATTCCCGCGTTTTTTACACCCACTGGCTACGGAACGTTAATACAAGAAGGCGGAGCTCCAATTAAATATAATAAAGATGGCACGATTGCTATAGCCAGCCAACCGAAGGAGGTGAAAGAATTCAGTGGGCGCCATTTTGTTATGGAAACTCAATCACAGGAGATTTTGCTTTAGTGAAAGCCTGGAAGGCAGATCTTGTGGAAAATATAGTGGTCAGGAAACAAGCAGAACTTCAACCAGCCCATGTGCAAACACCAAGTAACTGTGGTTTAGAGGGGGAGGGAAGATTGTTTAAAACGGGAAATTTGCCCCCCAAAGAAGTCCCCATTCCCCCCACCTACCTAAACCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGCTTGTAATCT

Sequences - 3ʹ (reverse) EST

Accession: JZ830033
dbEST ID: 79647735
Trimmed Sequence: ATCCTCAATCTGCTGAAGCTGCTTGAGATCTGGAGAAACTGCAAAGTCGCAGCCTGTGCATTTCTTGATATCTTCCACCGAAAGGCCTTCCCCGACTTCAATCAGCGTCAGCCCATTCTTTCTGTCCACATCAAAGACGGCCTTCTCCGTAATGATACGATCCACGCACTGTTTCCCAGTAAGTGGCAAGTTGCATTGTTCCAAAATTTTGTGAGAGCCGCCTTTGGCAGAGTGTTCCATAGTAACTACTACTTTTGTTCCGGAGCTGGAGACCAAATCCATGGCACCTCCCATTCCTTTCACCATCTTGCCAGGAATCATCCAGTTTGCAAGATCTCCGTACTTTGACACTTGCATTGCACCCAACATGGTCAAGTCAACATGACCCCCTCTAATCATAGCGAAGGAATCATCACTGGAAAAGTATGCGGCTCCTGGAAGCACAGTCACAGTTTCTTTACCTGCATTGATGAGGTCTGGATCTACTTCTTCTTCTACAGGATATGGACCCAGGCCCAGGACTCCATTTTCACTCTGAAGGTTGACTGTGATATCTTTTTTGATGAAGTTGCTTGCCAACATGGGAATACCAATGCCTAAATTTGCATACATGCCGTCTTGGAACTCTAGAGCCGCTCGACGAATAATCCTCTCTCTTTACATATCAGACTCTTTTTTGGGGCTTGGGTTTTGGATTTTTCAAAATTTTTTTAAATGTTTAGTCCTCCCCCATTTTTCTTTTGAAAAACTTTCCCCCCTTGGTAAACCC
Full Trace Sequence: GGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCCTCAATCTGCTGAAGCTGCTTGAGATCTGGAGAAACTGCAAAGTCGCAGCCTGTGCATTTCTTGATATCTTCCACCGAAAGGCCTTCCCCGACTTCAATCAGCGTCAGCCCATTCTTTCTGTCCACATCAAAGACGGCCTTCTCCGTAATGATACGATCCACGCACTGTTTCCCAGTAAGTGGCAAGTTGCATTGTTCCAAAATTTTGTGAGAGCCGCCTTTGGCAGAGTGTTCCATAGTAACTACTACTTTTGTTCCGGAGCTGGAGACCAAATCCATGGCACCTCCCATTCCTTTCACCATCTTGCCAGGAATCATCCAGTTTGCAAGATCTCCGTACTTTGACACTTGCATTGCACCCAACATGGTCAAGTCAACATGACCCCCTCTAATCATAGCGAAGGAATCATCACTGGAAAAGTATGCGGCTCCTGGAAGCACAGTCACAGTTTCTTTACCTGCATTGATGAGGTCTGGATCTACTTCTTCTTCTACAGGATATGGACCCAGGCCCAGGACTCCATTTTCACTCTGAAGGTTGACTGTGATATCTTTTTTGATGAAGTTGCTTGCCAACATGGGAATACCAATGCCTAAATTTGCATACATGCCGTCTTGGAACTCTAGAGCCGCTCGACGAATAATCCTCTCTCTTTACATATCAGACTCTTTTTTGGGGCTTGGGTTTTGGATTTTTCAAAATTTTTTTAAATGTTTAGTCCTCCCCCATTTTTCTTTTGAAAAACTTTCCCCCCTTGGTAAACCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCTCAATCTGCTGAAGCTG