ORFeome > p2rx4 ORF1 – XORFeome v1.0

p2rx4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: p2rx4
Gene ID: 967968
Gene Page ID: 967964
ORF Xenbase ID: 17287737

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC154994
Original XGC clone length: 1176

Human orthology & disease relationships

NCBI Entrez ID: 5025
Ensembl gene IDs: ENSG00000135124
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 117000,145600,192605,600996,604772

Library Location

Plate ID: GDExl11092
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ839006
dbEST ID: 79656708
Trimmed Sequence: ATGTCTAGGGACGGCTGCTGTGGGCAAGTGTACAGCTGCTTATTCGACTACGACACTCCGCGAATAGCGCTCATTAAGAGCAGGAAGATCGGACTCCTCAACAGGTTTATCCAGCTGGGAATCCTCGCTTATGTCATAGGGTGGGTTTTTATCTGGGAGAAAGGCTACCAGGAGTTTGATACAGTGGTCAGTTCTGTGACTTCTAAAGTGAAGGGAGTGGTTGTGACCAACACAACAGAACTGGGTGTCAAGATCTGGGATGTGGCAGATTACATTATACCAGCTCAGGAGGAAAATGCCGTCTTTGTTATGACCAATTTAATCCTTACCCAGAATCAAACCCAAGGTCACTGCCCTGAGTTACCTGAAACCAGTTTCTGTTCCAAAGAACAACCCTGTACCCCTGGTTATGTGGGCAAACAAAGCAACGGTGTACAGACTGGAAAGTGTGTGCCCTACAATTCTACAGTAAAAACCTGTGAAATTTTTGCATGGTGTCCAGTGGAAAATGATACTCATGTGCCAGATCCAGCATTTCTGAATGGGGCTGAGGACTTTACAGTTCTAATAAACAATAATATCTGGTATCCGAAATTCCAAGTCTCCCAACGAAACATATGGTCCAATATCAGCCGTAGTTAGCTCCAAACGTGCCCGTATGATGGAGGTGACCCACCCATCTCGTCCCATATTTCCACTTCGCCACATAGACAAAGAAAACAGGAAAATCCTTTCAGTGAACTTGCCTTTTCCGGGGAGGAAGGGAGGGGGGGGACAAAGAGCGGCGGGGAAATTGGGAACCCGGGGACGGGAAAAGGGTGCAAGGTGGGGGGT
Full Trace Sequence: TCGCGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTAGGGACGGCTGCTGTGGGCAAGTGTACAGCTGCTTATTCGACTACGACACTCCGCGAATAGCGCTCATTAAGAGCAGGAAGATCGGACTCCTCAACAGGTTTATCCAGCTGGGAATCCTCGCTTATGTCATAGGGTGGGTTTTTATCTGGGAGAAAGGCTACCAGGAGTTTGATACAGTGGTCAGTTCTGTGACTTCTAAAGTGAAGGGAGTGGTTGTGACCAACACAACAGAACTGGGTGTCAAGATCTGGGATGTGGCAGATTACATTATACCAGCTCAGGAGGAAAATGCCGTCTTTGTTATGACCAATTTAATCCTTACCCAGAATCAAACCCAAGGTCACTGCCCTGAGTTACCTGAAACCAGTTTCTGTTCCAAAGAACAACCCTGTACCCCTGGTTATGTGGGCAAACAAAGCAACGGTGTACAGACTGGAAAGTGTGTGCCCTACAATTCTACAGTAAAAACCTGTGAAATTTTTGCATGGTGTCCAGTGGAAAATGATACTCATGTGCCAGATCCAGCATTTCTGAATGGGGCTGAGGACTTTACAGTTCTAATAAACAATAATATCTGGTATCCGAAATTCCAAGTCTCCCAACGAAACATATGGTCCAATATCAGCCGTAGTTAGCTCCAAACGTGCCCGTATGATGGAGGTGACCCACCCATCTCGTCCCATATTTCCACTTCGCCACATAGACAAAGAAAACAGGAAAATCCTTTCAGTGAACTTGCCTTTTCCGGGGAGGAAGGGAGGGGGGGGACAAAGAGCGGCGGGGAAATTGGGAACCCGGGGACGGGAAAAGGGTGCAAGGTGGGGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTAGGGACGGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839005
dbEST ID: 79656707
Trimmed Sequence: AGGGTTTGATCCACATTCACTGCCAACCAGTTCATCATAATCTTCCACATATTTGTATTTCTTTTCTCGGTAGTAATGTCTTTTCTTAAAGAAATGGAAGACGATCATATCACACAGCACAGTTGCCACTCCAAACAAGGCAGCGCCGGAGCCAATGTTAATCATTGTAGGTATAATGTCGAATTTCCCCGCTGTTCCAAAAACCAGGATGTCAAAGCGGATCCCATAGACTTTCATCAGAGTTCTGGATTCAACACCGTTACTATCCTTATAATATTTAGCAAACCTGAAATTATAGCCGGGAGACACATTATGATCAATTTCTCTGTTGTCCAAGCGGCGGAATGAGTATTTTGGCACACAGTATGTAAGTTTCCGGTCCAGGTCACAGTTCCAGTTGATTTGTATCCCCATCACTCCTCCCTGAACAGCCATGTCACTGAAAGACTCTCCTGCTTCTTTTACTATGTTGCCGAGTCGAAATATTGGACAGAATGGGTGGTTCACTTTATCATACTGGCACGTTTTGAGGTAACTACTGCTGATATTGGACAATATGTTTCGTTTGGAGACTTGAAATTTTGGATACCAGATATTATTCTTTATTAGAACTGTAAAGTTTTCAGCCCCATTCAGAAATGCTTGAATCTGGCACAATGAGTAACCAATTTTCACTGGAAAACCAAGGCCAAAATTTCACAAGGGTTTTTTACCTGGAAAAAATGTAAGGGGCAAAACAACTTTTCCCAGTCCTTTAACACCCCTT
Full Trace Sequence: GAGAAAAATGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGGTTTGATCCACATTCACTGCCAACCAGTTCATCATAATCTTCCACATATTTGTATTTCTTTTCTCGGTAGTAATGTCTTTTCTTAAAGAAATGGAAGACGATCATATCACACAGCACAGTTGCCACTCCAAACAAGGCAGCGCCGGAGCCAATGTTAATCATTGTAGGTATAATGTCGAATTTCCCCGCTGTTCCAAAAACCAGGATGTCAAAGCGGATCCCATAGACTTTCATCAGAGTTCTGGATTCAACACCGTTACTATCCTTATAATATTTAGCAAACCTGAAATTATAGCCGGGAGACACATTATGATCAATTTCTCTGTTGTCCAAGCGGCGGAATGAGTATTTTGGCACACAGTATGTAAGTTTCCGGTCCAGGTCACAGTTCCAGTTGATTTGTATCCCCATCACTCCTCCCTGAACAGCCATGTCACTGAAAGACTCTCCTGCTTCTTTTACTATGTTGCCGAGTCGAAATATTGGACAGAATGGGTGGTTCACTTTATCATACTGGCACGTTTTGAGGTAACTACTGCTGATATTGGACAATATGTTTCGTTTGGAGACTTGAAATTTTGGATACCAGATATTATTCTTTATTAGAACTGTAAAGTTTTCAGCCCCATTCAGAAATGCTTGAATCTGGCACAATGAGTAACCAATTTTCACTGGAAAACCAAGGCCAAAATTTCACAAGGGTTTTTTACCTGGAAAAAATGTAAGGGGCAAAACAACTTTTCCCAGTCCTTTAACACCCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGGTTTGATCCACATTCAC