ORFeome > pabpn1 ORF1 – XORFeome v1.0

pabpn1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pabpn1
Gene ID: 1007055
Gene Page ID: 1007048
ORF Xenbase ID: 17287833

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045063
Original XGC clone length: 888

Human orthology & disease relationships

NCBI Entrez ID: 8106
Ensembl gene IDs: ENSG00000100836
Directly associated (OMIM) disease MIM numbers: 164300
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11011
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ823915
dbEST ID: 79641617
Trimmed Sequence: ATGGCTGCGGTGTCCTCGGTGGCGTCGCTGCGTGGGGCAGATTATGAGAACGGGCTACGCGGCGGGGCCGGACCCAGCGGCGGAGGGCAGGACCCAGGAGAGGACGACCCAATGGGCCGCGGCACGCTAGATTTGGATCTGGAACTGCTGACCCAGGGCAGAAGAAACCGGCGGGTTGGGGGCCGAACTGCTCCAGGCAGAAGATCCGGGGGACGCGGGGGCTCGGGAGGTGGAGCTGGTGGTTTAGAGGAGCTGGAAGATGAAGAGCTGGAGGAGGAAGAGCCTGGGGAACTCACGGGAGACCAAACCATAGAGGATCCGGAGCTTGAAGCCATTAAGGCTCGCGTGCGAGAGATGGAGGAGGAAGCTGAGAAGTTAAAAGAGCTTCAGAATGAAGTAGAAAAACAAATGAATATGAGCCCCCCTCCAGGCAATGCTGGGCCAGTAATCATGTCTGTTGAGGAGAAGATGGAAGCTGATGCACGATCAATTTATGTAGGAAATGTTGATTATGGCGCAACAGCAGAGGAACTTGAGGCTCATTCCATGGATGTGGTTCCGTCAATAGAGTTACCATACTATGCGACAAGTTCACTGGTCATCCAAAAGGGTTTGCCTACATTGAGTTATCTGATNAGGAATCAGTCAGAACTTCACTGGGCCTGGATGAATCTTTANTTTAGAGGACGTCAGAATTAAGGTCGTACCCCAAGAGGACAAACAGACCAGGTATCAGTAGAAACGGAACGAAGGTTTTCCCACGGGCAAGATAAGGAGCCAGGGCATCTTCCTTAAAGTTCTCCGGGCCCCCTTTCTTTCGGTGGCTACACCCCCCAACCCCA
Full Trace Sequence: ATGGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCGGTGTCCTCGGTGGCGTCGCTGCGTGGGGCAGATTATGAGAACGGGCTACGCGGCGGGGCCGGACCCAGCGGCGGAGGGCAGGACCCAGGAGAGGACGACCCAATGGGCCGCGGCACGCTAGATTTGGATCTGGAACTGCTGACCCAGGGCAGAAGAAACCGGCGGGTTGGGGGCCGAACTGCTCCAGGCAGAAGATCCGGGGGACGCGGGGGCTCGGGAGGTGGAGCTGGTGGTTTAGAGGAGCTGGAAGATGAAGAGCTGGAGGAGGAAGAGCCTGGGGAACTCACGGGAGACCAAACCATAGAGGATCCGGAGCTTGAAGCCATTAAGGCTCGCGTGCGAGAGATGGAGGAGGAAGCTGAGAAGTTAAAAGAGCTTCAGAATGAAGTAGAAAAACAAATGAATATGAGCCCCCCTCCAGGCAATGCTGGGCCAGTAATCATGTCTGTTGAGGAGAAGATGGAAGCTGATGCACGATCAATTTATGTAGGAAATGTTGATTATGGCGCAACAGCAGAGGAACTTGAGGCTCATTCCATGGATGTGGTTCCGTCAATAGAGTTACCATACTATGCGACAAGTTCACTGGTCATCCAAAAGGGTTTGCCTACATTGAGTTATCTGATNAGGAATCAGTCAGAACTTCACTGGGCCTGGATGAATCTTTANTTTAGAGGACGTCAGAATTAAGGTCGTACCCCAAGAGGACAAACAGACCAGGTATCAGTAGAAACGGAACGAAGGTTTTCCCACGGGCAAGATAAGGAGCCAGGGCATCTTCCTTAAAGTTCTCCGGGCCCCCTTTCTTTCGGTGGCTACACCCCCCAACCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCGGTGTCCTCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829224
dbEST ID: 79646926
Trimmed Sequence: GTAAGGAGTATACCATGACGTCGCGCGAGCCCGACCCCTGTACACACGTCCTCTGGGTCTGGGGGTGTAGCCACTGTAGAAACGGGACCGGGAACTGTAGGAAGATGCCCTGGCTCTGTATCTTGCCCGTGGGAAACCTCTGTCTGTCGTACTGATACCTGGTCTGTTGGTCCTCTTGGGTACGACCTTAATCTGACGTCCTCTAAATAAAGATTCATCCAAGGCCAGTGAAGTTCTGACTGATTCCTTATCAGAAAACTCAATGTAGGCAAACCCTTTTGGATGACCAGTGAACTTGTCGCATAGTATGGTAACTCTATTGACGGAACCACATCCATGGAAATGAGCCTCAAGTTCCTCTGCTGTTGCGCCATAATCAACATTTCCTACATAAATTGATCGTGCATCAGCTTCCATCTTCTCCTCAACAGACATGATTACTGGCCCAGCATTGCCTGGGAGGGGGCTCATATTCATTTGTTTTTCTACTTCATTCTGAAGCTCTTTTAACTTCTCAGCTTCCTCCTCCATCTCTCGCACGCCAACCCTAAGGGCTTCAAGCTCCCGAACCTCTATGGTTGGGTCTCCCGGGGATTCCCCAGGGCTCTTCCTCCTCCAGCTCCTTCATTTTCCAACTCCTCCAAACCAACCAGCTCCCCCCTCCCGAAGCCCCCCGGGGGCCCCCCGGAATCTTTCTGCCCTGGGAGCCGATTTCGGCCCCCCCAACCCCCCCGGGTTTTTTCTTTGGGCGC
Full Trace Sequence: GGACGAGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAAGGAGTATACCATGACGTCGCGCGAGCCCGACCCCTGTACACACGTCCTCTGGGTCTGGGGGTGTAGCCACTGTAGAAACGGGACCGGGAACTGTAGGAAGATGCCCTGGCTCTGTATCTTGCCCGTGGGAAACCTCTGTCTGTCGTACTGATACCTGGTCTGTTGGTCCTCTTGGGTACGACCTTAATCTGACGTCCTCTAAATAAAGATTCATCCAAGGCCAGTGAAGTTCTGACTGATTCCTTATCAGAAAACTCAATGTAGGCAAACCCTTTTGGATGACCAGTGAACTTGTCGCATAGTATGGTAACTCTATTGACGGAACCACATCCATGGAAATGAGCCTCAAGTTCCTCTGCTGTTGCGCCATAATCAACATTTCCTACATAAATTGATCGTGCATCAGCTTCCATCTTCTCCTCAACAGACATGATTACTGGCCCAGCATTGCCTGGGAGGGGGCTCATATTCATTTGTTTTTCTACTTCATTCTGAAGCTCTTTTAACTTCTCAGCTTCCTCCTCCATCTCTCGCACGCCAACCCTAAGGGCTTCAAGCTCCCGAACCTCTATGGTTGGGTCTCCCGGGGATTCCCCAGGGCTCTTCCTCCTCCAGCTCCTTCATTTTCCAACTCCTCCAAACCAACCAGCTCCCCCCTCCCGAAGCCCCCCGGGGGCCCCCCGGAATCTTTCTGCCCTGGGAGCCGATTTCGGCCCCCCCAACCCCCCCGGGTTTTTTCTTTGGGCGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAAGGAGTATACCATGACG