ORFeome > paf1 ORF1 – XORFeome v1.0

paf1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: paf1
Gene ID: 5797702
Gene Page ID: 5797650
ORF Xenbase ID: 17287851

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130057
Original XGC clone length: 1575

Human orthology & disease relationships

NCBI Entrez ID: 54623
Ensembl gene IDs: ENSG00000006712
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ837618
dbEST ID: 79655320
Trimmed Sequence: ATGGCTCCTACTATCCAGACTCAGGCACAGCGAGAGGACGGACATAGGTCCAGTTCTCATCGTACAGTTCCAGAGAGATCAGGGGTTGTCTGTCGTGTGAAATACTGCAACACGCTCCCTGATATTCCCTTTGACCCCAAGTTTATAACTTACCCTTTTGACCAGAACAGATTTGTACAGTATAAAGCCACATCGCTGGAGAAACAGCACAAGCATGACCTTCTGACGGAACCAGATTTGGGGGTAACCATTGACCTAATTAACCCGGATACCTATCGTATAGACCCCAATGTGACTCTTGATTTTGCTGATGAGAAGCTTCTAGAAGAGGAAATTCAGGCTCCCAGCAGCTCCAAAAGATCTCAGCAGCATGCTAAGGTTGTACCATGGATGAGGAAAACGGAATATATCTCCACGGAGTTTAACCGTTATGGTGTTTCCAATGAGAAGCCAGAAGTCAAGATTGGAGTTTCTGTCAAGCAGCAATTCACAGAGGAAGATATATATAAAGACAGAGACAGCCAGATTTCTGCCATTGAGAAGACCTTTGATGATGCCCAGAAAGATATTTCACAACATTATAGCAAGCCTCGTGTTACACCAATGGAGGTCATGCCAATCTTCCCAGAATTCAAGATGTGGATCAATCCCTGTGCTCAAGGTTATATTTGACTCAGATCCGGCA
Full Trace Sequence: GGCGGGCCCCAATAATTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCCTACTATCCAGACTCAGGCACAGCGAGAGGACGGACATAGGTCCAGTTCTCATCGTACAGTTCCAGAGAGATCAGGGGTTGTCTGTCGTGTGAAATACTGCAACACGCTCCCTGATATTCCCTTTGACCCCAAGTTTATAACTTACCCTTTTGACCAGAACAGATTTGTACAGTATAAAGCCACATCGCTGGAGAAACAGCACAAGCATGACCTTCTGACGGAACCAGATTTGGGGGTAACCATTGACCTAATTAACCCGGATACCTATCGTATAGACCCCAATGTGACTCTTGATTTTGCTGATGAGAAGCTTCTAGAAGAGGAAATTCAGGCTCCCAGCAGCTCCAAAAGATCTCAGCAGCATGCTAAGGTTGTACCATGGATGAGGAAAACGGAATATATCTCCACGGAGTTTAACCGTTATGGTGTTTCCAATGAGAAGCCAGAAGTCAAGATTGGAGTTTCTGTCAAGCAGCAATTCACAGAGGAAGATATATATAAAGACAGAGACAGCCAGATTTCTGCCATTGAGAAGACCTTTGATGATGCCCAGAAAGATATTTCACAACATTATAGCAAGCCTCGTGTTACACCAATGGAGGTCATGCCAATCTTCCCAGAATTCAAGATGTGGATCAATCCCTGTGCTCAAGGTTATATTTGACTCAGATCCGGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCCTACTATCCAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837617
dbEST ID: 79655319
Trimmed Sequence: GTCACTGTCACTTCCATCACTTGACCCAGAGCCCTGATCACTAGCACTTTGGTCCTCATTTTCCTGTTGTGAACGGTCACTACCAAATGGGCTACTGCTTGCACTACGGCTTCTGCGTCCCTGGCCTTTCTCTTCCTCCTCATCACTGCCACTATCCTCGCCATCTTGTCCACTCTCATTATGTCCATCTTCATCGCTATCATCGTCGTCATCATCATCATCACTACCAAAGATCTCTTCCTTGTCTCTGGCAGCCCGGTCATCTTCACTACTCTCTTTCTCCTGCTCATCTTCCTTCTCCTCTTCTTCAGCCCCCTCTCTCTCACTCTCACTGCCAGATTGCTCTGCACCGCTTCCTTCTTTCTCACTTCCGCTGCCCTTTTCTCCTTCTTCAGCATCTGAGCCCTGTGTATCCCGGTCGACCTCAATTTCTTCCTCTTCTTCGGGTTCATGATTCTCCAGTTGAGCTCTTCGTGCTTCCTGAGCTTCCAGTTCCTTCTCATGCATGTCTCTGTGTTTCACCACAAGCAAAGCATTTGTACCTGACTGAACACCAGCCTTAACTCTCCTCTTACTGAGTCGTACTCTAATTTCCAGTTCGTTATATACACCCCATCACCTTCCCAAAAAATAAGAAGTAATTCTCCCTCAAATCCTTTTGCTGGCCCTGGTTCTTA
Full Trace Sequence: CGGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCACTGTCACTTCCATCACTTGACCCAGAGCCCTGATCACTAGCACTTTGGTCCTCATTTTCCTGTTGTGAACGGTCACTACCAAATGGGCTACTGCTTGCACTACGGCTTCTGCGTCCCTGGCCTTTCTCTTCCTCCTCATCACTGCCACTATCCTCGCCATCTTGTCCACTCTCATTATGTCCATCTTCATCGCTATCATCGTCGTCATCATCATCATCACTACCAAAGATCTCTTCCTTGTCTCTGGCAGCCCGGTCATCTTCACTACTCTCTTTCTCCTGCTCATCTTCCTTCTCCTCTTCTTCAGCCCCCTCTCTCTCACTCTCACTGCCAGATTGCTCTGCACCGCTTCCTTCTTTCTCACTTCCGCTGCCCTTTTCTCCTTCTTCAGCATCTGAGCCCTGTGTATCCCGGTCGACCTCAATTTCTTCCTCTTCTTCGGGTTCATGATTCTCCAGTTGAGCTCTTCGTGCTTCCTGAGCTTCCAGTTCCTTCTCATGCATGTCTCTGTGTTTCACCACAAGCAAAGCATTTGTACCTGACTGAACACCAGCCTTAACTCTCCTCTTACTGAGTCGTACTCTAATTTCCAGTTCGTTATATACACCCCATCACCTTCCCAAAAAATAAGAAGTAATTCTCCCTCAAATCCTTTTGCTGGCCCTGGTTCTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCACTGTCACTTCCATCACT