ORFeome > pagr1 ORF1 – XORFeome v1.0

pagr1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pagr1
Gene ID: 5914184
Gene Page ID: 5914138
ORF Xenbase ID: 17287875

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC123182
Original XGC clone length: 630

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ838098
dbEST ID: 79655800
Trimmed Sequence: ATGGAGTCATTGGCCGTAAAGGAAGGAGGAGAAGAGGAGGAAGAGGAAGAAGTGGAAGGACAGCAGAAAGCAGAAGAGGAAGAAGCAGATGAACAACAAGAACAGGGGGAAGAGGAAGGGGAAGCAGAAGAGGAGGAAGGGGAAGACTGGTGTATAGGTTGCAGTGATGAGGAGGTTGAGGAACCTGATGGGTGGATTCCACCCCCTGAAGACATTAAAAGACTTTATGAGTTGTTGGCCAAAGAGGGAACGCTGCCTTTGCAAGTTGACATGCTCCTCCGTCGGCCTCCCACCCCTGAACCCGACTCTCTGGATGATGAATCTGATCAAGAGGGAGAGGAGGAAGAAGATGAGCAAGAGACGCCAAACGTTCCCACTGAATTTGATTTTGATGATGAACCGGTCGCCCCCCCAAATTCGCTACTTGATCGCCGGAGAACGCCGGGGAGCACCGGCCGCGGTCGCAGTAGAGAGGCCCGGGTGGACAAGGTTCTGTCCGACATCGATCCCCACAAAAACATCGGGGAACAGATCCTAAAGACTGGCCGTGCCCTCTTCGACGTGGAGCCGGACTCCGTTCCTCCCCCAGAGGGCGCGTCGGCCTTCGTCCCTCCCCCCCGGGAGTGCGTGCCGACTTGCTTGTATAAATTTGGGGGCTAGGGAGATCTTACTTATGGGTTTTTTCCAGGGGGGCGGGTCCTATCGGTCCAAGGGGGGTCTAATTTTCAATATAGGGGCGGATNNNNNNAAAAAAAAAAAAAAAAAAAAGAAAAAGAAAAGCAGGGGGG
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTCATTGGCCGTAAAGGAAGGAGGAGAAGAGGAGGAAGAGGAAGAAGTGGAAGGACAGCAGAAAGCAGAAGAGGAAGAAGCAGATGAACAACAAGAACAGGGGGAAGAGGAAGGGGAAGCAGAAGAGGAGGAAGGGGAAGACTGGTGTATAGGTTGCAGTGATGAGGAGGTTGAGGAACCTGATGGGTGGATTCCACCCCCTGAAGACATTAAAAGACTTTATGAGTTGTTGGCCAAAGAGGGAACGCTGCCTTTGCAAGTTGACATGCTCCTCCGTCGGCCTCCCACCCCTGAACCCGACTCTCTGGATGATGAATCTGATCAAGAGGGAGAGGAGGAAGAAGATGAGCAAGAGACGCCAAACGTTCCCACTGAATTTGATTTTGATGATGAACCGGTCGCCCCCCCAAATTCGCTACTTGATCGCCGGAGAACGCCGGGGAGCACCGGCCGCGGTCGCAGTAGAGAGGCCCGGGTGGACAAGGTTCTGTCCGACATCGATCCCCACAAAAACATCGGGGAACAGATCCTAAAGACTGGCCGTGCCCTCTTCGACGTGGAGCCGGACTCCGTTCCTCCCCCAGAGGGCGCGTCGGCCTTCGTCCCTCCCCCCCGGGAGTGCGTGCCGACTTGCTTGTATAAATTTGGGGGCTAGGGAGATCTTACTTATGGGTTTTTTCCAGGGGGGCGGGTCCTATCGGTCCAAGGGGGGTCTAATTTTCAATATAGGGGCGGATNNNNNNAAAAAAAAAAAAAAAAAAAAGAAAAAGAAAAGCAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTCATTGGCCGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ838097
dbEST ID: 79655799
Trimmed Sequence: GTATTTCCGCTGACGAGGGAAGATGGCAGAAGAGCGTTTTGGGGTGGGAACGGAGTCGGGGTCCNTGTCGAAGAGGTCACGGCCAGTCTTTAGGATCTGTTCCTCGATCTTCTTGTGTCGCTTCATGTCGGACAGAACCTTGTCCAGTCGGGCCTCTCTCTTGTGACTGCGGCCGGTGCTCCCTGGCGTTCTCCGGCGATCAAGTAGCGAATTTTTGGGGGTGACCGGTTCATCATCAGAATCGAATTCAGTGGGAGCGTTTGGCGTCTCTTGCGCATCTTCTTCCTCCTCTCCCTGTTGATCAGATTCGTCATCCAGAGAGTCGGGTTCAAGCGTGGGAAGCGAGCTGGAGGAAATGTCATCTCTGACAAGTGTTTTTGGGGCTTTGGCAGACGCTCGTAAGCTCTGTTGCTGTTGTCGGCGGGGGGGGGGGGGGGCGTCACGTTCTCGACCCACACATCACAACGACAGGGCAGGGGAGGGATGGCTTTCAGNGGGGGGGGGCGGGGGGGGTGGGGGGGGGGGAGCGACGCGGGGGGGTGGGGGGGGGTCGCGCGCCCCGTCGCGGCGGTGGGGCGGCGGCCCTTTTTGGGATAGGGAAGGGGGGGGGAGAAGAGTTGGTGAATTGGGGGGGGGGGGGGAGGGTGGGGCGGCGCCGTGTTGGCCCAGGGGGGGGGTAGATTGGGGAATAGGTGTNCGGGGCTGTGGGNNNNNNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAGAAGAAGTGTGGAG
Full Trace Sequence: GGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTATTTCCGCTGACGAGGGAAGATGGCAGAAGAGCGTTTTGGGGTGGGAACGGAGTCGGGGTCCNTGTCGAAGAGGTCACGGCCAGTCTTTAGGATCTGTTCCTCGATCTTCTTGTGTCGCTTCATGTCGGACAGAACCTTGTCCAGTCGGGCCTCTCTCTTGTGACTGCGGCCGGTGCTCCCTGGCGTTCTCCGGCGATCAAGTAGCGAATTTTTGGGGGTGACCGGTTCATCATCAGAATCGAATTCAGTGGGAGCGTTTGGCGTCTCTTGCGCATCTTCTTCCTCCTCTCCCTGTTGATCAGATTCGTCATCCAGAGAGTCGGGTTCAAGCGTGGGAAGCGAGCTGGAGGAAATGTCATCTCTGACAAGTGTTTTTGGGGCTTTGGCAGACGCTCGTAAGCTCTGTTGCTGTTGTCGGCGGGGGGGGGGGGGGGCGTCACGTTCTCGACCCACACATCACAACGACAGGGCAGGGGAGGGATGGCTTTCAGNGGGGGGGGGCGGGGGGGGTGGGGGGGGGGGAGCGACGCGGGGGGGTGGGGGGGGGTCGCGCGCCCCGTCGCGGCGGTGGGGCGGCGGCCCTTTTTGGGATAGGGAAGGGGGGGGGAGAAGAGTTGGTGAATTGGGGGGGGGGGGGGAGGGTGGGGCGGCGCCGTGTTGGCCCAGGGGGGGGGTAGATTGGGGAATAGGTGTNCGGGGCTGTGGGNNNNNNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAGAAGAAGTGTGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATTTCCGCTGACGAGGGAAGAT