ORFeome > paics-prov ORF1 – XORFeome v1.0

paics-prov ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256631
Gene Page ID:
ORF Xenbase ID: 17287881

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041276
Original XGC clone length: 1278

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ823608
dbEST ID: 79641310
Trimmed Sequence: ATGGAGTCTTACGCAGAACTGAAGCTGGGTAAGAAATTAAATGAAGGGAAAACGAAAGAAGTGTACGAACTGCCCGAGCACCCTGGCTGCGTACTGATGAAGTCCAAAGACCTGATTACTGCCGGCGATGCAGTACGGAAAGATCACATGGAAGGGAAAGCCTCTATTTCCAACAAGACTACTAGCTGCGTCTTCAAACTGCTGCAGGAGGCTGGGATCAAAACGGCGTTTGTGCGGAAGTGCAGCGACGCGGCTTTCATTCCTACTCACTGCGAGATGATTCCCATTGAATGGGTGTGCCGCAGAATCGCCACGGGCTCATTCTTGAAGAGAAATCCTGGTGTTAAGGAAGGCTACAAATTCCTCCCCCCTAAAGTGGAGACCTTTTTTAAGGATGATGCCAACCATGATCCTCAGTGGTCTGAGGAACAACTGATCTCGGCAAAACTCAGCTGTGCAGGGCTTGTGATTGGTCAGGCTGAGGTGGATATCATGACTCACTCCACAGCGGCCATCTTTGAGATTCTAGAGAAGGCTTGGATGACTCAGGAGTGCACACTAGTAGACATGAAGATTGAGTTTGGGTGTGGATGTTACAAAGAAGGAGATTGTCCTCGCTGATGTTATTGATAATGACTCTTGGCGCCTGTGGCCGGCTGGGGACAAATCTCAACAGAAAGATAAGCAAACATATCGGGAANCTAAAGGAAGTGACACCCTGAGCTCTGCAGAATGGTGAAGAGAAACTTTTGAGTGGGTGGGCAGACAGA
Full Trace Sequence: CAGATATGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTCTTACGCAGAACTGAAGCTGGGTAAGAAATTAAATGAAGGGAAAACGAAAGAAGTGTACGAACTGCCCGAGCACCCTGGCTGCGTACTGATGAAGTCCAAAGACCTGATTACTGCCGGCGATGCAGTACGGAAAGATCACATGGAAGGGAAAGCCTCTATTTCCAACAAGACTACTAGCTGCGTCTTCAAACTGCTGCAGGAGGCTGGGATCAAAACGGCGTTTGTGCGGAAGTGCAGCGACGCGGCTTTCATTCCTACTCACTGCGAGATGATTCCCATTGAATGGGTGTGCCGCAGAATCGCCACGGGCTCATTCTTGAAGAGAAATCCTGGTGTTAAGGAAGGCTACAAATTCCTCCCCCCTAAAGTGGAGACCTTTTTTAAGGATGATGCCAACCATGATCCTCAGTGGTCTGAGGAACAACTGATCTCGGCAAAACTCAGCTGTGCAGGGCTTGTGATTGGTCAGGCTGAGGTGGATATCATGACTCACTCCACAGCGGCCATCTTTGAGATTCTAGAGAAGGCTTGGATGACTCAGGAGTGCACACTAGTAGACATGAAGATTGAGTTTGGGTGTGGATGTTACAAAGAAGGAGATTGTCCTCGCTGATGTTATTGATAATGACTCTTGGCGCCTGTGGCCGGCTGGGGACAAATCTCAACAGAAAGATAAGCAAACATATCGGGAANCTAAAGGAAGTGACACCCTGAGCTCTGCAGAATGGTGAAGAGAAACTTTTGAGTGGGTGGGCAGACAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTCTTACGCAGAACTGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ828907
dbEST ID: 79646609
Trimmed Sequence: GATGCTGCACTCCCTCAGCTTCATGTCCGCTTGCTTGAGAGATATCCAGGTGTTCAGGGTGCAGGAGCGGAGCTTGCACCACACTAGGTGGTTGTTTAAGCCAAAGATTTGAGCAGCAAACTGAGCTGCAGCTTCTGGTGAGAGAACGGTGGAACATCCAAGCCCACTGGGCATTCGGAGGGACGACCACACATCCTGTGCACCCCAATCTGCAGTGAGAGGGGGGCAGTTGATCACGGGATAAGCAGTGTTTCCAGACATGACCGGTCCCAAACCGTTGCTTCTGCCAGCCACTGCTATGAAGACTGTAGGAATGCCATCACCATCGTACTCAGACTTGATACGCAGGGTTTCATCCGGGCCTTTGTGTGCAGAAGTCACTCTCAGCTCACAGGGAATGCCATAGTTTGCACAGGATTTCTTTATCTTTTCGCAGTGTGCCAGGTCAGAAATGGATCCCATCAGCACCACCACCCTACCTTGGCTGTTTGACTTCAGCAGGAGCTCTACTCTGTCTGCCACCCACTCAAAGTTTCTCTTCACCATCTGCAGAGCTTCAGGTGTCACCTCCTTTAGTTTCCGATATGTTTGCTTATCTTTCTGTTGAGATTTTGTCCCAGCCGGGCACAGGCGCCAAGAGTCATTTATCAATAACATCAGCGAAGACAATTCTCCTTCTTTGTAACCTCCACAACCA
Full Trace Sequence: GGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGCTGCACTCCCTCAGCTTCATGTCCGCTTGCTTGAGAGATATCCAGGTGTTCAGGGTGCAGGAGCGGAGCTTGCACCACACTAGGTGGTTGTTTAAGCCAAAGATTTGAGCAGCAAACTGAGCTGCAGCTTCTGGTGAGAGAACGGTGGAACATCCAAGCCCACTGGGCATTCGGAGGGACGACCACACATCCTGTGCACCCCAATCTGCAGTGAGAGGGGGGCAGTTGATCACGGGATAAGCAGTGTTTCCAGACATGACCGGTCCCAAACCGTTGCTTCTGCCAGCCACTGCTATGAAGACTGTAGGAATGCCATCACCATCGTACTCAGACTTGATACGCAGGGTTTCATCCGGGCCTTTGTGTGCAGAAGTCACTCTCAGCTCACAGGGAATGCCATAGTTTGCACAGGATTTCTTTATCTTTTCGCAGTGTGCCAGGTCAGAAATGGATCCCATCAGCACCACCACCCTACCTTGGCTGTTTGACTTCAGCAGGAGCTCTACTCTGTCTGCCACCCACTCAAAGTTTCTCTTCACCATCTGCAGAGCTTCAGGTGTCACCTCCTTTAGTTTCCGATATGTTTGCTTATCTTTCTGTTGAGATTTTGTCCCAGCCGGGCACAGGCGCCAAGAGTCATTTATCAATAACATCAGCGAAGACAATTCTCCTTCTTTGTAACCTCCACAACCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGCTGCACTCCCTCAGCTT