ORFeome > parpbp ORF1 – XORFeome v1.0

parpbp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: parpbp
Gene ID: 1004679
Gene Page ID: 1004673
ORF Xenbase ID: 17288091

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108807
Original XGC clone length: 1704

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ837700
dbEST ID: 79655402
Trimmed Sequence: ATGGATTGTCCTCATCAAGATGTGTTGCATTTAATCAAATACTTTCGAAAAGAGTGGCCTGTTGTGTCTGATTCTGAGAGAACAACAATATGTGGCGCAGACAATATGCTTCTGACTTTACAGTTGGCTCTTGCCGAGGTTAATAAACAGAATGGCAAAGAATTTTCTGTATCTCTTAGTGATGTGCTGCTAACATGGAAATATTTGGTAAAACATAAGCTTGGCCTTGCTTGTGAAGACACAGTGGTTCCAAAGGATTATGCAGATATCCAGAAGACCTATGATCTGTTCCTGAAAAACAGTAATTCATTGGATTTAATTGATATTTATGAAAAGATCTCAACAGCCGGTTCCAGTGAGGCACATTTCTTATCCTCAGAACAGCTGTTAGACTTTCTCACCAATGACGTATGCTTGTCAGAAGGTACAGATTTTCCAATAGTATCAACTCCCTGTAAAAATAACCTGGATACTGTGAAGGTAAAACCAACATTGAAAAGGATATTTCTTGCTTATTTAAATTTACTGGTAAACGCTAAAAATGATTTTGCCTTGTCACAAGTACTTATTTGCCCAAAGAGGGGATTAAGAAGAGAAGCATTTACTGACCTGAAACACACCTCAAGGTTGAAAAATATGTCCCTTTTTCTTGGTGGCTACATCTTTCATAAGAACTATTGAGCTTTAAAGGTAAAGGTTATGCCCCATCCGGGATTGGATCCCCTTCGGAAAAACCTAAAGAGAACTTTCCCTGTTCTTTTCCTTTTTTTTGTT
Full Trace Sequence: CGGGGGCCCCATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATTGTCCTCATCAAGATGTGTTGCATTTAATCAAATACTTTCGAAAAGAGTGGCCTGTTGTGTCTGATTCTGAGAGAACAACAATATGTGGCGCAGACAATATGCTTCTGACTTTACAGTTGGCTCTTGCCGAGGTTAATAAACAGAATGGCAAAGAATTTTCTGTATCTCTTAGTGATGTGCTGCTAACATGGAAATATTTGGTAAAACATAAGCTTGGCCTTGCTTGTGAAGACACAGTGGTTCCAAAGGATTATGCAGATATCCAGAAGACCTATGATCTGTTCCTGAAAAACAGTAATTCATTGGATTTAATTGATATTTATGAAAAGATCTCAACAGCCGGTTCCAGTGAGGCACATTTCTTATCCTCAGAACAGCTGTTAGACTTTCTCACCAATGACGTATGCTTGTCAGAAGGTACAGATTTTCCAATAGTATCAACTCCCTGTAAAAATAACCTGGATACTGTGAAGGTAAAACCAACATTGAAAAGGATATTTCTTGCTTATTTAAATTTACTGGTAAACGCTAAAAATGATTTTGCCTTGTCACAAGTACTTATTTGCCCAAAGAGGGGATTAAGAAGAGAAGCATTTACTGACCTGAAACACACCTCAAGGTTGAAAAATATGTCCCTTTTTCTTGGTGGCTACATCTTTCATAAGAACTATTGAGCTTTAAAGGTAAAGGTTATGCCCCATCCGGGATTGGATCCCCTTCGGAAAAACCTAAAGAGAACTTTCCCTGTTCTTTTCCTTTTTTTTGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTGTCCTCATCAAGATGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837699
dbEST ID: 79655401
Trimmed Sequence: GACCCTGAAGAAGCTGGTTAATTTGGCTTGTCCAGTAATTAGTTTGTTCTTTGATGCTTTGTTTCTAGATACACCCTGTTTATTTGCCTTTGAGGATGTTAGCTCAACTACTGCTTTCTTTTGTGGGGGTTCATTCTCCTGTCCATTTGTGGTTTCACTCTGTATGTCCACTTGCTTCCTCTTTGACCTTTTGTTCCCCACATTTTTGCATGGTTTGTTCTTTACTTGCTCAGCAGTTTTGAGGTCAATATTTCCAGAACTCTGTTTAAGTCCTTTTTGCAAGTCATTTTCTAATGGCTCCTCATCAAAACAGAGTACTGGAACAATTTTTGGTGCTGGATGAATACAACTTGGCACTTGGCTCATACTTGGAAAATCCCATTGTTTTGTTTGAGTCAAGTTACTGTCTTTATAGGTGCAGGCAAATTGTGATCGGATTAGGTTATGTTTCAACTTTGGTTTATCTTTGTTTATAGCTTTCTGCACACGTTGACTTAAAGCTTTGGGGGAAGATCCAGTCTGTTCAGGAGACCTAAATAGGGTAAAGAGAGAGAAAGCTCCAAAAAGGGTATTTTCTTCATCAGCACAAAGAAGATCTGCTTTGTTTTTGCTAGGAGGATTTGCATCTTCTTCATCCAAAAGTTTTAACAGAGTTTTTATTGTTTCCCTACCACCTGAAACAATGCCACGGTTTATGGCCCCAATTTTAGGGCGTACTGGGCTGAAACCTGTGGTGCCACTAGATTTATCCTCACTAACTAAAATAATAAGGTATTTAATCCCGAGAAGCCAGGTCTGTGCAGGTTACGTTGGCTGCGCGGCTGGTGGAACCCCGCTTGGCGCGTTCCTTTATAAAAAACAAAATGAATGGAAACGAGCACAGCCCCAATTCTATTTCTGGGATCTTGAGTTAGTTCAAAAAATTCTATTACTTCGATTAATTCAAGTAACAAAAAAACAAAAGGTCCATTATAATTGTTTCCCTGATGGGAGAGAGGACGAAAAGAAGAAAACCATTTAACCTCGAAACATACAAAGATTTTAAACTAACAAATGTGACCCCCACAAAAAAATGGACGGGTTTTCTTGGAAGGGAGAGGGGGTTTTGGTGCGTTGCTGTTGGGGGGGTTCTGGCTCTCTTCTACCTCTCTTTTTGGCCCGCCAGTATGCGCCAAGTGGCAGCGGGCGCGGGGGGAGGGGCAGACCTCTTATGTTTTGGGGGGTGTGTTGGCGAGGGGAGGAGGATTTGAGGAGGAAT
Full Trace Sequence: GGCCGGGGTAACAGCTATGGACCATGTAATACGACTCACTATNAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACCCTGAAGAAGCTGGTTAATTTGGCTTGTCCAGTAATTAGTTTGTTCTTTGATGCTTTGTTTCTAGATACACCCTGTTTATTTGCCTTTGAGGATGTTAGCTCAACTACTGCTTTCTTTTGTGGGGGTTCATTCTCCTGTCCATTTGTGGTTTCACTCTGTATGTCCACTTGCTTCCTCTTTGACCTTTTGTTCCCCACATTTTTGCATGGTTTGTTCTTTACTTGCTCAGCAGTTTTGAGGTCAATATTTCCAGAACTCTGTTTAAGTCCTTTTTGCAAGTCATTTTCTAATGGCTCCTCATCAAAACAGAGTACTGGAACAATTTTTGGTGCTGGATGAATACAACTTGGCACTTGGCTCATACTTGGAAAATCCCATTGTTTTGTTTGAGTCAAGTTACTGTCTTTATAGGTGCAGGCAAATTGTGATCGGATTAGGTTATGTTTCAACTTTGGTTTATCTTTGTTTATAGCTTTCTGCACACGTTGACTTAAAGCTTTGGGGGAAGATCCAGTCTGTTCAGGAGACCTAAATAGGGTAAAGAGAGAGAAAGCTCCAAAAAGGGTATTTTCTTCATCAGCACAAAGAAGATCTGCTTTGTTTTTGCTAGGAGGATTTGCATCTTCTTCATCCAAAAGTTTTAACAGAGTTTTTATTGTTTCCCTACCACCTGAAACAATGCCACGGTTTATGGCCCCAATTTTAGGGCGTACTGGGCTGAAACCTGTGGTGCCACTAGATTTATCCTCACTAACTAAAATAATAAGGTATTTAATCCCGAGAAGCCAGGTCTGTGCAGGTTACGTTGGCTGCGCGGCTGGTGGAACCCCGCTTGGCGCGTTCCTTTATAAAAAACAAAATGAATGGAAACGAGCACAGCCCCAATTCTATTTCTGGGATCTTGAGTTAGTTCAAAAAATTCTATTACTTCGATTAATTCAAGTAACAAAAAAACAAAAGGTCCATTATAATTGTTTCCCTGATGGGAGAGAGGACGAAAAGAAGAAAACCATTTAACCTCGAAACATACAAAGATTTTAAACTAACAAATGTGACCCCCACAAAAAAATGGACGGGTTTTCTTGGAAGGGAGAGGGGGTTTTGGTGCGTTGCTGTTGGGGGGGTTCTGGCTCTCTTCTACCTCTCTTTTTGGCCCGCCAGTATGCGCCAAGTGGCAGCGGGCGCGGGGGGAGGGGCAGACCTCTTATGTTTTGGGGGGTGTGTTGGCGAGGGGAGGAGGATTTGAGGAGGAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACCCTGAAGAAGCTGGTT