ORFeome > pars2 ORF1 – XORFeome v1.0

pars2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pars2
Gene ID: 6256361
Gene Page ID: 6049466
ORF Xenbase ID: 17288097

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC044273
Original XGC clone length: 1401

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ824080
dbEST ID: 79641782
Trimmed Sequence: ATGGTGTGGTTGTTGAGAGCATGCTGCAGAGTATCGCTGCCTCACATAGTCACATGCAGGAATCATCATGTTTCAGCTAAAGGGAAACGTCGCTTGTTGTCTCGGCTATACCAGCCTAGGAGTCTTTGGGAGGTAAAATCCTCTGAAACGGAATCCAAGCCCAATGAGCCCACAAGTAAGAGCCAGAAGCTCATGATCAAGGCAGGTTTAATCCGTCCCTCCAACCCTGGATGTTTTCACTACCTACCATACACTGTGCGTGCCATGGAGAAGCTGATCCGTTTGATTGACAAAGAAATGCAGGACATTGGTGGACAGAAGATTGACATGCCAACCTTAGGCTCGGCTGCACTGTGGAGGCAGAGTGGACGGTGGGATTTAATGGGAAAAGAACTTTTCCGTTTGAAGGATAGACATAACCAGGAATACTGCTTGGGTCCTACTCATGAAGAGCTTGTCACACACCTTGTTGCTTCAGAGGGTGGCATTAACAACAAAGAACTTCCTTTGCTTCTTTACCAGATAACAAGAAAGTTTCGAGATGAGCAAAGGCCGTGCTTTGGTTTGCTACGTGGCAGAGAGTTTTACATGAAAGATATGTATACCTTTGATATATCAGAAGAATCGGCATATGAAACATATAGAAATGTGTGTGATGCCTACTCAAACATTTTTAGGGCACTGGGAGTTCATTTTGTGAAAGTTCAAGCAGATACAGGCAATATTGGTGGGAAAATGTCCCATGAATTCCACTTGCCTGCAAATATTGGGGGAGGACAGGTTAACTGGTGTTGTGGGGAGCTTGTAACTTCCTCTGCCCAATGTAAAAGCTTATTAACCGGCATGGAA
Full Trace Sequence: ATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGTGGTTGTTGAGAGCATGCTGCAGAGTATCGCTGCCTCACATAGTCACATGCAGGAATCATCATGTTTCAGCTAAAGGGAAACGTCGCTTGTTGTCTCGGCTATACCAGCCTAGGAGTCTTTGGGAGGTAAAATCCTCTGAAACGGAATCCAAGCCCAATGAGCCCACAAGTAAGAGCCAGAAGCTCATGATCAAGGCAGGTTTAATCCGTCCCTCCAACCCTGGATGTTTTCACTACCTACCATACACTGTGCGTGCCATGGAGAAGCTGATCCGTTTGATTGACAAAGAAATGCAGGACATTGGTGGACAGAAGATTGACATGCCAACCTTAGGCTCGGCTGCACTGTGGAGGCAGAGTGGACGGTGGGATTTAATGGGAAAAGAACTTTTCCGTTTGAAGGATAGACATAACCAGGAATACTGCTTGGGTCCTACTCATGAAGAGCTTGTCACACACCTTGTTGCTTCAGAGGGTGGCATTAACAACAAAGAACTTCCTTTGCTTCTTTACCAGATAACAAGAAAGTTTCGAGATGAGCAAAGGCCGTGCTTTGGTTTGCTACGTGGCAGAGAGTTTTACATGAAAGATATGTATACCTTTGATATATCAGAAGAATCGGCATATGAAACATATAGAAATGTGTGTGATGCCTACTCAAACATTTTTAGGGCACTGGGAGTTCATTTTGTGAAAGTTCAAGCAGATACAGGCAATATTGGTGGGAAAATGTCCCATGAATTCCACTTGCCTGCAAATATTGGGGGAGGACAGGTTAACTGGTGTTGTGGGGAGCTTGTAACTTCCTCTGCCCAATGTAAAAGCTTATTAACCGGCATGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGTGGTTGTTGAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829388
dbEST ID: 79647090
Trimmed Sequence: GATTACTTCTACTCTCCGTAAAAAGTCAATTACACCTTCTCTAGACAAAAAGTGCACTTCATCTGTGTTATGACTCCTTACTTCAAACAAAGATGGGGTCTCTAAAGCCTTCTTGCCAATAACAATGACATATGGATAACCCATCATATGGGCTTCTTTAACCCGTTTACCAATAGTCAGATAACTCCTATCATCCAAAACAGTCTCATCTCTGAGCCCACAAACTGACTGTATAATATCATCATAAAGTGTTTCTGCAACAGATATGGCTTCTATTTCTTTGCTTCCTTTCTTTGGGGAAATCAGACAAACTTGATAAGGAGCAATAAGTCCAGGCCAATGAATATCATCTTCATTGCTGAGAACTTCCAAGGAAGCTGCCAGTAGTCTTGAAACACCAATCCCATAACAACCCATTTCTGCTAAAAAAGGTGTTTTCTGAGAATCATAGCAATTAGCCTTAAAAACATGGGAATATTTAGTGCCAAGATAGAAAGTATGTCCTATCTCAATGCCTTTAGTCTCTTTTAACTGCCCTGTGCACACTGGACAGTTCTTTTCATCATGCAGTAATAGCTCTACATTGGCAGAGAAGTCACAGCTCCCACCCACCAATAAACCGGTCCTCCCCCATAATTGGCAGGGAAGTGGAATTCAGGGGAACAATTTTTCCCCCAATATTGGCCTGGATCCTGCTTGAACTTTTCCAAAAAAGAAACCTCCCCGGGGCCCCAAAAAAGGTTTGAGAAAAAAGGCATCCCCAAAAA
Full Trace Sequence: GGACAGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATTACTTCTACTCTCCGTAAAAAGTCAATTACACCTTCTCTAGACAAAAAGTGCACTTCATCTGTGTTATGACTCCTTACTTCAAACAAAGATGGGGTCTCTAAAGCCTTCTTGCCAATAACAATGACATATGGATAACCCATCATATGGGCTTCTTTAACCCGTTTACCAATAGTCAGATAACTCCTATCATCCAAAACAGTCTCATCTCTGAGCCCACAAACTGACTGTATAATATCATCATAAAGTGTTTCTGCAACAGATATGGCTTCTATTTCTTTGCTTCCTTTCTTTGGGGAAATCAGACAAACTTGATAAGGAGCAATAAGTCCAGGCCAATGAATATCATCTTCATTGCTGAGAACTTCCAAGGAAGCTGCCAGTAGTCTTGAAACACCAATCCCATAACAACCCATTTCTGCTAAAAAAGGTGTTTTCTGAGAATCATAGCAATTAGCCTTAAAAACATGGGAATATTTAGTGCCAAGATAGAAAGTATGTCCTATCTCAATGCCTTTAGTCTCTTTTAACTGCCCTGTGCACACTGGACAGTTCTTTTCATCATGCAGTAATAGCTCTACATTGGCAGAGAAGTCACAGCTCCCACCCACCAATAAACCGGTCCTCCCCCATAATTGGCAGGGAAGTGGAATTCAGGGGAACAATTTTTCCCCCAATATTGGCCTGGATCCTGCTTGAACTTTTCCAAAAAAGAAACCTCCCCGGGGCCCCAAAAAAGGTTTGAGAAAAAAGGCATCCCCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATTACTTCTACTCTCCGTAAAAA