ORFeome > parvb ORF1 – XORFeome v1.0

parvb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: parvb
Gene ID: 947906
Gene Page ID: 947899
ORF Xenbase ID: 17288103

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097781
Original XGC clone length: 1098

Human orthology & disease relationships

NCBI Entrez ID: 29780
Ensembl gene IDs: ENSG00000188677
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,125800,161800,182290,301000,313900,600652,603278,603622,605249,607841,608751

Library Location

Plate ID: GDExl11089
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ838429
dbEST ID: 79656131
Trimmed Sequence: ATGTCCAGCACCCCAGTCAGGTCACCCACCCTCCAGGGCCAAAAGATGAAGAAGGACGAATCATTCCTGGGGAAACTGGGAGGGACCCTGGTCAGGAAGAAGAAAGCCAAAGAGGTGAGTGATCTCCAGGAAGAGGGTAAAAATGCCATCAATGCACCCATGTCACCCACCCCCATCGATCTGCACCCAGAGGACACCCTGCTTGAGGAGAATGAGGAACGCACCATGATCGACCCCAATTCCAAGGAAGAGACCAAATTCAAGGAGCTTGTGAAGGTCCTTATTGACTGGATTAATGAGGTTCTGGTCGAGGAGAGAATTATTGTGAAGAATTTGGAAGAGGATCTGTATGACGGGCAGGTGCTGCAGAAACTTCTAGAGACACTGGGGAGTCGGAAGCTGAATGTTGCGGAGGTCACACAGTCCGAGATTGGGCAGAAGCAGAAGCTACAGACAGTTCTGGAAGCCGTACAGGAGCTGCTGAGACCTCAGGGGTGGGCCATAAGGTGGAACGTTGACTCCATCCATGGGAAAAACCTGGTGGCAATTCTGCACCTTCTGGTGGCGCTGGCGATGCATTTCCGGGCTCCAATCCGCCTCCCTGAGCACGTGTGTGTACAAGTTGTAGTAGTGAAGAAGCGCGAGGGTTTGTTGCAGACGGCACATGTGACCGAGGAGCTGACCACCCCCACTGAGATGATGATGGGCAAATTT
Full Trace Sequence: CGTGGGCCCACATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCAGCACCCCAGTCAGGTCACCCACCCTCCAGGGCCAAAAGATGAAGAAGGACGAATCATTCCTGGGGAAACTGGGAGGGACCCTGGTCAGGAAGAAGAAAGCCAAAGAGGTGAGTGATCTCCAGGAAGAGGGTAAAAATGCCATCAATGCACCCATGTCACCCACCCCCATCGATCTGCACCCAGAGGACACCCTGCTTGAGGAGAATGAGGAACGCACCATGATCGACCCCAATTCCAAGGAAGAGACCAAATTCAAGGAGCTTGTGAAGGTCCTTATTGACTGGATTAATGAGGTTCTGGTCGAGGAGAGAATTATTGTGAAGAATTTGGAAGAGGATCTGTATGACGGGCAGGTGCTGCAGAAACTTCTAGAGACACTGGGGAGTCGGAAGCTGAATGTTGCGGAGGTCACACAGTCCGAGATTGGGCAGAAGCAGAAGCTACAGACAGTTCTGGAAGCCGTACAGGAGCTGCTGAGACCTCAGGGGTGGGCCATAAGGTGGAACGTTGACTCCATCCATGGGAAAAACCTGGTGGCAATTCTGCACCTTCTGGTGGCGCTGGCGATGCATTTCCGGGCTCCAATCCGCCTCCCTGAGCACGTGTGTGTACAAGTTGTAGTAGTGAAGAAGCGCGAGGGTTTGTTGCAGACGGCACATGTGACCGAGGAGCTGACCACCCCCACTGAGATGATGATGGGCAAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCAGCACCCCAGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838428
dbEST ID: 79656130
Trimmed Sequence: GTCAAGGTGCTTGTACTTTGTAAATAGATTATATAACACTCGCAGAGTCGACTTTAGGTCAAGATTGACAATATCTTCAGGCCTGGCTTTCGGCTTCTTCAGCCCCCCGTCCTGCATCAGCTCAAAGGAGAAGGCGACATTGTGAACCGTCTGTTCAAAGCCTTCTGGCGTCAGGTAGAAATTATGAAGAGGAACAAAATAACCTTCGAGGAGCCCCATGAGCAGCACCAGGTAAACTCCGTCTGCAAACTGAGTCTCCAACTCTGTCACTTCCAAATTCAACTTGTTCAGATGTTTATTCACAAACGTGATCAAGGACTTCTTAACAACACTCAGTTTGTCAGGGGCGTGGTCAAATAAAGTGTCAAATGCATCGCGCTCAAATTTGCCCATCATCATCTCAGTGGTGGTTGTCAGCTCCTCGGTCACATGTGCCGTCTGCAACAAACCCTCGCGCTTCTTCACTACTACAACTTGTACACACACGTGCTCAGGGAGGCGGATTGGAGCCCCGAAATGCATCGCCAGCGCCACCCCAAGGTGCAGAATTGCCACCAGGTTTTTCCCATGGGAGGAGTCAACGTTTCCCCTTATTGGCGACGCCCTGAGGTCTCAGCAGCTCCCGGACCGGCTTCGAGAAGCTGGCCGGTAACTTTCTGCTTTCTGGCCAAATTTCCGAAATTG
Full Trace Sequence: GGGAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCAAGGTGCTTGTACTTTGTAAATAGATTATATAACACTCGCAGAGTCGACTTTAGGTCAAGATTGACAATATCTTCAGGCCTGGCTTTCGGCTTCTTCAGCCCCCCGTCCTGCATCAGCTCAAAGGAGAAGGCGACATTGTGAACCGTCTGTTCAAAGCCTTCTGGCGTCAGGTAGAAATTATGAAGAGGAACAAAATAACCTTCGAGGAGCCCCATGAGCAGCACCAGGTAAACTCCGTCTGCAAACTGAGTCTCCAACTCTGTCACTTCCAAATTCAACTTGTTCAGATGTTTATTCACAAACGTGATCAAGGACTTCTTAACAACACTCAGTTTGTCAGGGGCGTGGTCAAATAAAGTGTCAAATGCATCGCGCTCAAATTTGCCCATCATCATCTCAGTGGTGGTTGTCAGCTCCTCGGTCACATGTGCCGTCTGCAACAAACCCTCGCGCTTCTTCACTACTACAACTTGTACACACACGTGCTCAGGGAGGCGGATTGGAGCCCCGAAATGCATCGCCAGCGCCACCCCAAGGTGCAGAATTGCCACCAGGTTTTTCCCATGGGAGGAGTCAACGTTTCCCCTTATTGGCGACGCCCTGAGGTCTCAGCAGCTCCCGGACCGGCTTCGAGAAGCTGGCCGGTAACTTTCTGCTTTCTGGCCAAATTTCCGAAATTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCAAGGTGCTTGTACTTTGTAA